1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnom [1K]
3 years ago
8

Many factors affect rigor mortis, such as the type of clothing the person was wearing. Experts from different sciences agree tha

t the definition of death is the end of life. Blowflies are one of the first insects to arrive at a dead body and are very useful in determining the time of death. Livor mortis refers to the color of a dead body. The only two manners of death are natural death and homicidal death. Mechanism of death describes what has occured in the body to cause death. The presence of drugs in a corpse cannot be determined by a chemical analysis of larvae found feeding on the body. In the first 12 hours, a dead body cools about 1 degree F per hour. Within minutes of a death, certain insects are attracted by the smell of the first stages of decomposition. The Body Farm is a fictional account of the work of a country coroner.
Biology
1 answer:
Anna71 [15]3 years ago
4 0

Answer:

- Many factors affect rigor mortis, such as the type of clothing the person was wearing. True

- Experts from different sciences agree that the definition of death is the end of life. True

- Blowflies are one of the first insects to arrive at a dead body and are very useful in determining the time of death. True

- Livor mortis refers to the color of a dead body. True

- The only two manners of death are natural death and homicidal death. False

- Mechanism of death describes what has occured in the body to cause death. True

- The presence of drugs in a corpse cannot be determined by a chemical analysis of larvae found feeding on the body. True

- In the first 12 hours, a dead body cools about 1 degree F per hour. False

- Within minutes of a death, certain insects are attracted by the smell of the first stages of decomposition. True

- The Body Farm is a fictional account of the work of a country coroner. False

Explanation:

Death refers to the permanent cessation of the biological activities in an organism as a whole. <em>Rigor mortis</em> refers to a recognizable sign of death, which is caused by different changes in the muscles after death. Blowflies are insects that can be attracted by the smell of dead and decomposing bodies because they need to identify warm-moist and protein-rich sources to develop their eggs. Livor mortis is the red/blue/purple discoloration in the body skin after death. The manners of death can be divided into 1-accidental, 2-natural, 3-suicidal, 4-homicidal, and 5-undetermined. The mechanisms of death refer to the specific physiological derangements that can lead to the cessation of life (e.g., a heart attack), whose understanding can be essential to elucidate a criminal case. The presence of drugs in a dead body can be determined by an autopsy. The rate at which a dead body cooling depends on the relationship between the body temperature and environmental temperature (e.g, elevated body temperatures and cool environmental conditions are known to increase this value). A body farm can be defined as a research facility where the decomposition of dead bodies can be examined.

You might be interested in
Cellular respiration is the process that converts
Angelina_Jolie [31]

Answer:

Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.

Simplified reaction: C₆H₁₂O₆ (s) + 6 O₂ (g) → 6 CO₂ (g) + 6 H₂O (l) + heat

Explanation:

Answer expert verified.

5 0
3 years ago
Read 2 more answers
Give an example of the way sexual selection can cause extreme phenotypes in a population
STatiana [176]
<span>When breeding season arrives, male elephant seals define and defend territories. They collect a harem of 40 to 50 females, which are much smaller than their enormous mates. </span>
7 0
3 years ago
The modern approach to classification, with the broader goal of reconstructing the evolutionary history, or phylogeny, of organi
olga55 [171]

Answer:

systematics is the correct answer.

Explanation:

  • The modern approach to classification, with the broader goal of reconstructing the evolutionary history, or phylogeny, of organisms is: systematics.
  • Systematics plays an important role in the field of biology.
  • Carl Linnæus is the father of Systematics.
  • Systematics refers to the study of the diversification,nomenclature, and classification of the living organism in the past and also in present.
  • Systematics is used to understand the evolutionary relationship and the purpose of systematics is to describe and explain biological variety.
  • The main objective of systematics is to identify species and to give scientific names to organisms, it used to determine the arrangement of the living organism and to study the evolutionary history of organisms.

3 0
3 years ago
Does hydrogen and helium act almost like a furnace in the sun?
viktelen [127]

Answer:

Yes

Explanation:

Two isotopes of hydrogen, tritium and protium, undergo nuclear fusion in the sun to give helium, neutrons and a tremendous amount of energy. This reaction occurs at the very high temperature found in the sun and yields tremendous amount of energy.

Given the high temperature at which the said fusion reaction occurs, it is safe to say that hydrogen and helium act as a furnace at the core of the sun.

8 0
3 years ago
Name classifications of matter used In the 1800
Veronika [31]
The choices can be found elsewhere and as follows:

<span>atural and synthetic
metabolites and nonmetabolites
proteins, carbohydrates, lipids, and nucleic acids
organic compounds and inorganic compounds

I think the correct answer from the choices is the third option. The c</span>lassifications of matter used In the 1800 are proteins, carbohydrates, lipids, and nucleic acids. Hope this helps.
8 0
3 years ago
Other questions:
  • Explain to Erica what inappropriate internet usage on the job look like.
    11·1 answer
  • Joe is color blind. both his mother and his father have normal vision, but his mother's father (joe's maternal grandfather) is c
    9·1 answer
  • Microevolution _____.
    10·2 answers
  • These yogurts are good sources of ____, which contain active cultures of beneficial bacteria.
    8·1 answer
  • I'd like some help with these please
    11·1 answer
  • National parks reduce the human impact on land by _______. a. permitting limited human development. b. cleaning up litter c. pre
    10·2 answers
  • Natural selection of favorable adaptations in organisms often results in
    7·2 answers
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • Question 3 (1 point)
    15·1 answer
  • Explain the difference in the rate of diffusion between the experiment using 1 drop of ammonia and the experiment using 3 drops
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!