1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TiliK225 [7]
3 years ago
8

Which of the following statements correctly identifies a way in which prokaryotic cells are different from eukaryotic cells?

Biology
1 answer:
Taya2010 [7]3 years ago
4 0

Answer:

Prokaryotic cell has undeveloped nucleus but eukaryotic cell has well developed nucleus.

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
The image shows a magnified view of a leaf's surface with the stomata visible. What’s the significance of these structures in th
Deffense [45]

The correct answer is option (d) They allow the exchange of gases between cells in the leaf and the external environment.

Stomata are the tiny openings present in the epidermis (outer layer of cells) of the leaf. They have a pore which is guarded by the guard cells which controls the opening and closing of the stomata. Air enters and exits through the stomata.

The main funtion of stomata is to facilitate the gaseous exchange. The gas exchange that occurs when the stomata are open helps in the process of photosynthesis. During photosynthesis, carbon dioxide is taken in from the atmosphere and oxygen is released as a by-product of photosynthesis. The glucose produced is converted into the starch and stored in the leaves.

Also, water vapour diffuses through the stomata into the atmosphere by a process called the transpiration.

Thus, stomata are the structures that are mainly involved in the gaseous exchange between the cells of the leaf and the atmosphere.

8 0
3 years ago
Read 2 more answers
A group of organisms of the same species that live together in the same place at the same time are called a/an
Usimov [2.4K]
It is called  a population since they are all the same species 
3 0
3 years ago
Read 2 more answers
Asexual reproduction can be advantageous for species that colonize new areas.
max2010maxim [7]

Answer:

True

Explanation:

It can rapidly increase if the environment is good for them

6 0
3 years ago
An endospore may survive a drought because it is protected by a
dmitriy555 [2]

Answer:

b. thick wall.

Explanation:

Endospore is a structure formed by some bacteria, that help them survive unfavourable conditions (e.g. lack of nutrients). This survival strategy of some bacteria (usually Gram+ bacteria) help them stay dormant for a while, until stressful conditions stop. A thick wall composed of many layers (exosporium, spore coat, spore cortex, core wall) of the endospore is what provides resistance to different stressful chemical and physical factors such as UV radiation, temperature, chemical damage etc.

5 0
3 years ago
Other questions:
  • What process is responsible for producing 2n zygote
    8·1 answer
  • PLEASE HELP!! Would you expect to find many fluorescent organisms in the very deep ocean? Why or why not?
    5·1 answer
  • What kind of cell division has the same number of chromosomes after every division ?
    7·2 answers
  • Which of the following statements is false?
    9·1 answer
  • Explain why reducing surface runoff is the most general way to reduce water pollution.
    6·1 answer
  • In genetics is the mother x or y
    9·2 answers
  • Describes three types of stimuli that cause plants to exhibit tropism.
    7·2 answers
  • Name 4 things that happen during telophase.
    6·2 answers
  • Saadasdasdasdasd<br>as<br>d<br>asd<br>as<br>das<br>d<br>asd
    8·1 answer
  • in the adult digestive tract, where do lipases break fat into fragments so that it can be absorbed into the lymph?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!