1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s2008m [1.1K]
2 years ago
14

Which two words best describe the Sun? Select one:

Biology
2 answers:
Rasek [7]2 years ago
8 0
I think the answer is

C) star and gases
Zielflug [23.3K]2 years ago
5 0

Answer:

I'm pretty sure it would be c

Explanation:

because it is a star so it definitely is not a or d and I don't think it is rocky soooo

You might be interested in
Which phrase best describes a meteoroid
Licemer1 [7]
Hello!

The phrase that best describes a meteoroid is "Small pieces of rock and dust in space"

Meteoroids are small bodies of the solar system. They are rocks between 100 μm -50 m in diameter that are smaller than comets and asteroids and bigger than cosmic dust. They commonly are fragments of comets and asteroids that had been separated from them by heavy impacts. When a meteoroid enters the atmosphere, it burns, and the glow that this burn produces is what we call "shooting stars". However, the correct definition is the mentioned above.

Have a nice day!
6 0
3 years ago
Guys I need help with the first one pls I will appreciate it
zhuklara [117]

Answer:

I'm almost positive it's answer c. :)

7 0
2 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Scientists can produce many plants in the lab by cloning; culturing a few plant cells in a test tube of chemical medium. Few cel
tester [92]

Answer:

in the epicenter

Explanation:

In a Venn Diagram that compares and contrasts the different characteristics or features of the produced plants, "cloning" would be in the epicenter. This is because through the process of "cloning" you are basically copying the core genetic makeup of the plant and creating a brand new plant that shares all of the exact same characteristics and features as the plant's whose genetic makeup was used as a baseline.

7 0
2 years ago
Based on these concepts, choose statements that correlate Mendel's four postulates with what is now known about genes, alleles,
Vikentia [17]

Answer:

Explanation:

Mendel four postulate is Principles of Paired Factors, Principle of Dominance, Law of Segregation which is Mendels First Law of Inheritance and Law of Independent Assortment which is Mendel’s Second Law of Inheritance.

The six possible outcome are,

3. Alleles segregate from each other during gamete formation at anaphase I gene assorts independent of each other during gametes formation.

4. Some genes have dominant and recessive alleles. Allele of a gene can either be dominant or recessive in its form

7. Unit factors occur in pairs , allele of a gene occur in pair

Dominant alleles can become codominant alleles during mitosis, when two allele both finds expression in the phenotype of an organism they are codominant

8. One gene pair separates independently from other gene pairs independent assessment of gene.

5. Different gene pairs on nonhomologous chromosomes will separate independently from each other during meiosis.

5 0
2 years ago
Other questions:
  • When the two substances are put in the same container, they do not attract each other. why does this happen?
    7·2 answers
  • What is biology and things related to it​
    9·2 answers
  • Unlike photosynthesis cellular respiration occurs in?
    6·1 answer
  • Skin cells are attached to the extracellular matrix by
    14·1 answer
  • What are the 3 substances which are reabsorbed from the nephron in the blood?
    9·1 answer
  • Faults are
    14·2 answers
  • Match the following terms and definitions. 1. two or more units are added together to form a new compound law of mass action 2.
    10·1 answer
  • What could have caused this situation?
    10·1 answer
  • What do the results suggest about ways that milkweed bug populations are limited in nature?
    8·1 answer
  • What property of the carbon atom makes it unique?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!