1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kenny6666 [7]
3 years ago
8

Would the correct protein be made if TRNA did not work correctly?

Biology
1 answer:
galina1969 [7]3 years ago
6 0

Answer:

The short answers are Yes, it's random, and Yes, it "waits" for some time.

Different tRNA's just float around in the cytoplasma, and diffuse more or less freely around. When one happens to bump into the ribosome, at the right spot, right orientation, and of course which has an anticodon matching the codon in frame of the mRNA being translated, it gets bound and takes part in the synthesis step that adds the amino acid to the protein that is being synthesized.

The concentration of the various species of tRNA is such that translation occurs in a steady fashion, but there is always some waiting involved for a suitable tRNA to be bound. In that waiting time, the ribosome and mRNA stay aligned - that's because the energy that is required to move the to the next position is delivered as part of the same chemical reaction that transfers the amino acid from the tRNA to the protein that is being synthesized.

I'm not entirely sure what happens if there is significant depletion of a particular species of tRNA, but I think it's likely the ribosome / RNA complex can disassemble spontaneously. But spontaneous disassembly can't be something that occurs very easily after translation was initiated, since we would end up with lots of partial proteins which I expect would be lethal very soon.

(Can't know for sure though, but it would be very hard to set up an experiment to measure just what will happen and even if you got a measurement it would be hard to figure out how it applies to normal, living cells. I can't imagine tRNA depletion occurs in normal, healthy living cells.)

You might be interested in
Which of these types of weathering requires the presence of water?
serg [7]

Answer:

A. Abrasion

Explanation:

<em>"In abrasion, one rock bumps against another rock. Gravity causes abrasion as a rock tumbles down a mountainside or cliff. Moving water causes abrasion as particles in the water collide and bump against one another."</em>

<em>-Lumen Learning</em>

8 0
3 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
How many calories are in an average trick-or-treaters halloween stash?
Vera_Pavlovna [14]

The number of calories on a Halloween stash depends on the type of candies and the number of units of each. If the stash contains 5 units of each of these candies: chocolate bars, taffies, lollypops, and candy corn the total number of calories is 1,650.

Calories are the most common unit used to define the energy a specific food gives to your body. For example, an apple has 52 calories, while a banana has 89 calories.

Considering this, in a Halloween stash the calories depend on two factors:

  • The types of candies or products
  • The units of each one

Let's suppose there are 5 units of each of the following candies:

  • Chocolate bars
  • Taffies
  • Lollypops
  • Candy corn

Let's now calculate the calories

  • Chocolate bars = 220 calories x 5 units =  1,100 calories
  • Taffies = 20 calories x 5 units = 100 calories
  • Lollypops = 83 calories x 5 units = 415 calories
  • Candy corn = 7 calories x 5 = 35 calories

Add all the previous results:

1,100 + 100 + 415 + 35 = 1,650 calories in total

Learn more in brainly.com/question/22374134

8 0
3 years ago
Which of the following accurately demonstrates the DNA base pairing rule
charle [14.2K]
The base pairing rules<span> for </span>DNA<span> are governed by the complementary </span>base pairs<span>: adenine (A) with thymine (T) in an A-T </span>pairing<span> and cytosine (C) with guanine (G) in a C-G </span>pairing<span>. Conversely, thymine only binds with adenine in a T-A </span>pairing<span> and guanine only binds with cytosine in a G-C </span>pairing<span>.</span>


I hope my answer has come to your help. God bless and have a nice day ahead!

4 0
4 years ago
Ancient plants begin to resemble modern plants during the Devonian period. TRUE FALSE
SVETLANKA909090 [29]

Answer:

True

Explanation:

The Devonian Period comprises the years between 416 million and 354 million and is subdivided by periods: Lower (the oldest), Middle and Upper (the most recent).

During this period, the main transformations occurred in the flora, with the exponential growth of small terrestrial plants through the development of spores. With this process, plants will become more similar with modern plants. During this period the plants were able to fertilize themselves with the seeds and reach the height of trees. They formed the first forests to be recorded, with the appearance of licopodia, ferns and progimosperms.

5 0
3 years ago
Read 2 more answers
Other questions:
  • _______ are the small sacs that are the site of gas exchange in the lungs. In addition to being an airway, the _______ is the lo
    14·1 answer
  • The skin condition caused by hyposecretion of the oil glands and is an inherited condition is known as
    5·1 answer
  • Which answer choice correctly lists the level of organization from most basic to most complex
    6·1 answer
  • You decide to clone a gene using a plasmid vector featuring ampicillin resistance and lacz. however, when you try to grow the
    7·1 answer
  • List three types of asexual reproductions (other than vegetative) and define each in a short paragraph.
    7·1 answer
  • Please help me but them in the right box!!! Will give brainlist :)
    11·1 answer
  • Objects need to be in contact with each other in order to experience friction.
    6·2 answers
  • If the Pacific Ocean is rimmed by the Ring of Fire, what can we conclude about the plate boundaries in that region?
    9·1 answer
  • Houston is seeing a huge growth in population, including cutting down trees and clearing fields in order to build larger roads a
    8·1 answer
  • Reducing, reusing, and recycling are used to Group of answer choices make more ores increase metal production burn fossil fuels
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!