1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
12

1.)What is an interesting fact about wildlife biologists?

Biology
1 answer:
oee [108]3 years ago
6 0

Answer: Below::

Explanation:

1) Most job sites for wildlife biologists are at a state or federal agency/ level.

2) A Bachelor of Science Degree

3) Wildlife Biologists study wildlife (such as animals and plants) and how they interact with their ecosystems. On land and in water.

You might be interested in
Where is the greatest concentration of nitrogen? which organisms make it usable?
Inga [223]
<span>The greatest concentration of nitrogen on the Earth is found in its atmosphere. The atmosphere is approximately 78 percent nitrogen. and second one bacteria</span>
7 0
3 years ago
Which trait is used to evaluate the writer’s tone? A. sentence fluency B. conventions C. organization D. voice Please select the
mart [117]
D. voice, i think if not its a
8 0
3 years ago
Read 2 more answers
How do earths surface features indicate changes over time? Someone please help.
Natali5045456 [20]
Continents move and the earth's surface changes over time
3 0
3 years ago
Which organelle from the plant cell is primarily responsible for converting sunlight to energy???
solmaris [256]
Chloroplasts
Chloroplasts are organelles found in plant cells and eukaryotic algae that conduct photosynthesis. Chloroplasts absorb sunlight and use it in conjunction with water and carbon dioxide gas to produce food for the plant.
7 0
3 years ago
Help me please!!!
Alexandra [31]

Answer:

The answer is D

Explanation:

MRNA synthesis

7 0
3 years ago
Other questions:
  • Infants require many nutrients early in life, including lipids such as fats. A low-fat diet for infants is not recommended becau
    5·1 answer
  • BAINLIESTTT ASAP!!
    15·2 answers
  • What is the special features of the rock chert?
    8·2 answers
  • What is the best method to show a change in volume over time?
    14·1 answer
  • What is the atomic number of an atom that has 6 protons 6 neutrons and 6 electrons
    9·2 answers
  • What is the primary source of energy for food chains in an ecosystem
    9·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • What happens when an object in space moves towards us
    11·1 answer
  • 35 POINTS List 7 advantages. What is the main problem with hay as an energy source??
    7·1 answer
  • Which chemical weathering process involves the action of carbonic acid
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!