1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Musya8 [376]
3 years ago
6

All organisms contain dna, and every organisms DNA is made up of 4 nucleotides. the difference between organisms is simply based

on there order of these nucleotides. since all organisms have the same basic universal structure for dna, which of these must be universal?
A. All organisms have the same proteins
B. All living things must have the same amount of DNA
C. All organisms must be genetically identical to each other.
D. All matching codons in all organisms DNA code for the same amino acids.​
Biology
1 answer:
ad-work [718]3 years ago
3 0

All matching codons in all organisms DNA code for the same amino acids.

Option D.

<h3><u>Explanation:</u></h3>

Codons are defined as group of three nucleotide bases that forms a triplet, and codes for a particular amino acid.

There are four nitrogen bases, so four possible nucleotides. Among them, 3 are stop codons, rest 61 are codons denoting the 20 amino acids. Codons are discrete, meaning no same codon codes for more than 1 amino acid.

And these codons are universal. It means, like AUG denotes for amino acid methionine, and that is same in bacteria, as well as in all organisms. So they are universal.

You might be interested in
In the test tube shown, what is produced by the snail that is used by the plant?
kkurt [141]

Answer:

just trying to get more points because I need them also this old so yeah

Explanation:

yeah yeah yeah yeah

3 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
What is the phase that the fusion in a star no longer occurs
Damm [24]
NUCLEAR FUSION, hope it helps
6 0
3 years ago
If the force exerted on a sled is 100 N and the mass of the sled is 50 kg, what is the acceleration of the sled?
Anna35 [415]
<h3><u>Answer;</u></h3>

acceleration= 2 m/s²

<h3><u>Explanation;</u></h3>

From the second Newton's Law of motion the resultant force is directly proportional to the rate of change in momentum.

That is;

F = ma

Thus; F = 100 N, m = 50 kg

a = F/m

  = 100/50

  = 2 m/s²

8 0
3 years ago
How do neurons work?
kenny6666 [7]

A neuron (also known as nerve cell) is an electrically excitable cell that takes up, processes and transmits information through electrical and chemical signals. It is one of the basic elements of the nervous system. In order that a human being can react to his environment, neurons transport stimuli.

4 0
3 years ago
Other questions:
  • The pair of population graphs below display the results of two different five-year hunting cycles, one on light trees and one on
    5·2 answers
  • Which two factors can both cause a population to increase
    11·2 answers
  • 1. Two atoms are the same element if they have the same
    6·2 answers
  • What is being released during Glycolysis?
    15·2 answers
  • Which best describes a gamma ray?
    12·1 answer
  • Which is observation proves that a cell is a eukaryote?
    11·1 answer
  • The observable traits expressed by an organism are described as its ________.
    7·1 answer
  • The movement of molecules down a concentration gradient through transport proteins in the cell membrane is a type of
    5·1 answer
  • Why do organisms have different niches?​
    12·1 answer
  • I know this might be too much, but can somebody help me with some of it? :(
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!