1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
3 years ago
5

Lance was an ecologist studying DCA, a pollutant released from dye factories. He found that it impaired the function of centriol

es. What would be the likely consequenceto cells?A. Cells cannot divide.
B. Cells cannot process energy.
C. Cells cannot remove wastes.
D. Cells cannot absorb food.
E. Cells cannot make proteins.
Biology
1 answer:
klasskru [66]3 years ago
3 0

Answer: Option A is the correct option.

Cell cannot divide.

Explanation:

Cell cannot divide if centriole is impaired because centriole is cylindrical tube like organelle that is found in eukaryotic cells and it is made up of microtubules and this centrioles help in cell division by cause the chromosomes to separate. They are located close to the nucleus and help in cell division. Therefore, if the centriole is impaired, it will not be able to facilitate cell division since it's ability to to form spindle fiber which separate chromosomes .

You might be interested in
List and explain the function of four organelles found in eukaryotic cells.<br> HELP NOW !
Elan Coil [88]

Explanation:

Below is a list of organelles that are commonly found in eukaryotic cells.

Organelle: Function

Nucleus: The “brains” of the cell, the nucleus directs cell activities and contains genetic material called chromosomes made of DNA.

Mitochondria: Make energy out of food

Ribosomes: Make protein

Golgi Apparatus: Make, process and package proteins

Lysosome: Contains digestive enzymes to help break food down

Endoplasmic Reticulum: Called the "intracellular highway" because it is for transporting all sorts of items around the cell.

Vacuole: Used for storage, vacuoles usually contain water or food. (Are you are thirsty? Perhaps your vacuoles need some water!)

Plant cells also have:

Chloroplasts: Use sunlight to create food by photosynthesis

Cell Wall: For support

5 0
3 years ago
What is an annealing
slega [8]

Explanation:

heat (metal or glass) and allow it to cool slowly, in order to remove internal stresses and toughen it.

OR

recombine (DNA) in the double-stranded form following separation by heat.

6 0
3 years ago
Read 2 more answers
A man hit a ball (0.2kg) which the accelerates at a rat of 20m/s2
dimulka [17.4K]
Just divide I think
8 0
3 years ago
Read 2 more answers
A cell or an organ that responds to commands of the control center in negative feedback is termed a(n)
Oduvanchick [21]
Effector tissue or organ
4 0
3 years ago
What is not true about anaerobic respiration?
jasenka [17]
It uses a little oxygen - it uses none
8 0
3 years ago
Other questions:
  • Which of the following is not true concerning the zebra mussel in the united states?
    7·2 answers
  • During which stage of cellular respiration is glucose broken down into two molecules of pyruvic acid?
    11·1 answer
  • How are oxygen and nitrogen molecules different from the water molecules?
    6·1 answer
  • What effect would herbicide that runs off from a golf course have on an estuary?
    8·1 answer
  • The warmer the temperature is outside the more mosquitoes that are flying around
    11·1 answer
  • Assume that the mother's genotype is AZ/az, and the father's genotype is Az/aZ, and the recombination rate is 10%. What are the
    15·1 answer
  • ) which is not a major function of the kidney? which is the normal ph range of urine in humans?
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is bicorn in sican
    9·1 answer
  • In which situation would it be least likely for a scientist to revise her experimental methods?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!