Answer:
Water is required for germination. Mature seeds are often extremely dry and need to take in significant amounts of...
Oxygen is required by the germinating seed for metabolism. Oxygen is used in aerobic respiration, the main source of the...
Temperature affects cellular metabolic and growth rates. Seeds from different species and even seeds from the same plant.
Explanation:
Answer:
External fertilization usually occurs in aquatic environments where both eggs and sperm are released into the water Most external fertilization happens during the process of spawning where one or several females release their eggs and the male(s) release sperm in the same area, at the same time.
Typically, frogs lay eggs. This process usually occurs through external fertilization, where the female releases her eggs from her body into water. Then, the male releases his sperm to fertilize them In this case, the eggs are fertilized inside the female's body before they are released.
Question: How does oceanic crust move along mid ocean ridges
Answer: Oceanic crust slowly moves away from mid-ocean ridges and sites of seafloor spreading
Explanation: as a result it becomes cooler, more dense, and more thick.
question answered by
(jacemorris04)
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
oxygen
Explanation:
A limiting factor is any condition whose decrease, increase, absence or presence is able to limit/stop population growth. Examples of limiting factors include abiotic conditions (e.g., temperature, water, oxygen, CO2, etc) or biotic conditions (e.g., food, mate, etc). There are many aquatic species that require high levels of oxygen (e.g., fish), thus being it a limiting factor for these species.
