1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivolga24 [154]
3 years ago
9

Juan has collected a cricket. Which question can a dichotomous key help him

Biology
1 answer:
Lubov Fominskaja [6]3 years ago
8 0
What species the cricket is
You might be interested in
Chains of blank form polymers?
Alja [10]

Answer:

Chains of linked carbon and hydrogen atoms

Explanation:

3 0
3 years ago
All you need is in the photo ​
just olya [345]

Answer:

Im pretty sure it's C? Maybe it's D though.

7 0
3 years ago
The nurse admitting a patient to the emergency department on a very hot summer day would suspect hyperthermia when the patient d
olya-2409 [2.1K]

The heart rate increases with hyperthermia. With hypothermia there is slow capillary refill. Hydration is very important with hyperthermia and it is tag as danger of dehydration, but there is not the same risk with hypothermia. Vasodilatation happens causing the skin to look flushed and warm or hot to touch. There is an increased respiration rate with hyperthermia. 

7 0
3 years ago
A substance synthesized at the cell body must undergo ______ transport to reach the synaptic knobs.
cricket20 [7]

The cell body must undergo Anterograde transport to reach the synaptic knobs.

The synaptic feature is to transmit nerve impulses between two nerve cell neurons or among a neuron and muscle cellular. Synapses connect one neuron to every other and are thus liable for the transmission of messages from the nerves to the mind and vice versa.

Synapses are a part of the circuit that connects sensory organs, like those who come across aches or touch, within the peripheral frightened gadget to the mind. Synapses connect neurons inside the mind to neurons inside the rest of the frame and from those neurons to the muscle tissues.

Synaptic transmission is the method at synapses by way of which a chemical sign is launched from one neuron and diffuses to other neurons or goal cells where it generates a sign which excites, inhibits, or modulates mobile hobby.

Learn more about synaptic here:-

brainly.com/question/27888471

#SPJ4

5 0
1 year ago
How is the division of the cytoplasm different in plants and in animals?
Serhud [2]
The most observable difference is the way in which cytokinesis occurs. In plants a new cell wall is fashioned between the new daughter cells, while in animal cells the cell membrane constricts to pinch the parent cell into daughter cells.
3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Genes alone do not determine development; environmental forces also shape development. This information has led to the understan
    7·2 answers
  • Why is reducing caloric intake insufficient for a person to loose weight in a healthy way?
    12·2 answers
  • What does ATP add to the Calvin-Benson cycle?
    6·1 answer
  • Cladistics is a way of classifying organisms by examining the characteristics of their ancestors and descendants and depicting t
    5·2 answers
  • What is the ten science process??
    13·1 answer
  • Demographic transitions is change from high birthrates and high death rates to
    15·1 answer
  • 7. Sister chromatids are
    5·2 answers
  • How could sedimentary rock become igneous rock? List the steps.
    8·1 answer
  • Drea is comparing three organisms. Two have many of the same characteristics. But they have very few characteristics in common w
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!