1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
2 years ago
15

Which statement best describes the effect that an increased amount of atmospheric carbon has on plants?

Biology
1 answer:
Lelechka [254]2 years ago
7 0
Plants will require less water
You might be interested in
Plz help!!! First and Last attempt!!
Sladkaya [172]
The answer is b it is being bred for a trait that is favored by humans
7 0
3 years ago
Animal cells contain all of the following structures EXCEPT a what?
weeeeeb [17]
They do not have a cell wall because only plant cells have that. The plant cells have that to help with the process for creating the green color. The animal cells, instead, they have a cell membrane.
5 0
3 years ago
Read 2 more answers
Which of these sentences demonstrates the noun-verb-adverb pattern?
valina [46]

Answer:

D.

Explanation:

I think its D. sorry if its wrong

3 0
3 years ago
Which method is often used in the disposal of medical waste
RideAnS [48]
Usually if we are talking about needles and body fluids, They are usually put into a box that is labeled hazard! And they dispose of the materials in a special trash can! :) Hope this helps!
7 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Witch of the following is also known as the hydrologic cycle?
    8·2 answers
  • Although low growling or barking is often associated with aggressive behavior, one must consider the context in which the behavi
    12·1 answer
  • Cells, organelles, and tissues are usually measured in __________.
    9·1 answer
  • Put the steps of the greenhouse effect in the correct order.
    8·1 answer
  • Question 4: Suppose there were changes in the habitat that caused this actual value. What might a
    11·1 answer
  • What are the eight different elements that cereal contains​
    14·1 answer
  • Which describes the function of a peptide bond?'
    10·1 answer
  • In eukaryotes, where do transcription regulators bind?
    8·1 answer
  • How do a dwarf planet and an asteroid differ?
    13·1 answer
  • How are rocks formed?<br><br> igneaus sedimentary metamorphic
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!