Answer:
They heat up and they stay the same I believe, my teacher helped me with it so its heat up and stay the same or move. Something like that.
Explanation:
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Georgia is the world's leading producer of Kaolin (china clay).
Explanation:
Kaolin or china clay contains the mineral kaolinite mainly. It also contains varying amounts of other minerals like muscovite, feldspar, quartz, etc. In order to prepare it for commercial use, the clay in its natural form is then chemically treated and washed with water to remove the other minerals.
Kaolin is extensively used in the ceramic industry and the paper-coating industry. The high fusion temperature and white burning characteristics are used in the ceramic industry for the manufacture of chinaware, porcelain, and refractories. In the paper-coating industry, the kaolin is mixed with the cellulose fiber in the paper sheet. This gives the paper its color, opacity, and printability. It is also used as a pigment additive in paints, as a filler in plastic and rubber compounds, and in pharmaceuticals.
<span>The same amount of wax exists before and after the change.
Wax when melted will be like liquid. Liquid has no definite shape, but definite volume.</span>
Answer:
get a cheat sheet like fr
Explanation: