1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Digiron [165]
1 year ago
6

Pigment molecules capturing photons in the chloroplast are organized in distinct structures called.

Biology
1 answer:
hjlf1 year ago
4 0

Pigment molecules capturing photons in the chloroplast are organized in distinct structures called photosystems.

Photosynthetic pigments, which include chlorophyll a, chlorophyll b, and carotenoids, are light-harvesting molecules found in chloroplast thylakoid membranes. As previously stated, pigments and proteins are organized into complexes known as photosystems.

Photosystems are functional units for photosynthesis that are defined by specific pigment organization and association patterns. Their work is the absorption and transfer of light energy, which implies electron transfer. Photosystems are physically found in thylakoid membranes.

Chloroplasts are chlorophyll-containing organelles found in plant cells; they are essential for life on Earth because photosynthesis occurs in chloroplasts. Proplastids give rise to chloroplasts, as do chromoplasts, leucoplasts, and other plastids. Light energy absorption and conversion into biological energy

To learn more about photosystems and chloroplasts, here

brainly.com/question/13776808

#SPJ4

You might be interested in
Particles of the ground that have a lot of energy can do two different things with this energy. What are these two things?​
Gwar [14]

Answer:

They heat up and they stay the same I believe, my teacher helped me with it so its heat up and stay the same or move. Something like that.

Explanation:

5 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Georgia is the world's leading producer of this type of clay used in the manufacturing of
kap26 [50]

Answer:

Georgia is the world's leading producer of Kaolin (china clay).

Explanation:

Kaolin or china clay contains the mineral kaolinite mainly. It also contains varying amounts of other minerals like muscovite, feldspar, quartz, etc. In order to prepare it for commercial use, the clay in its natural form is then chemically treated and washed with water to remove the other minerals.

Kaolin is extensively used in the ceramic industry and the paper-coating industry. The high fusion temperature and white burning characteristics are used in the ceramic industry for the manufacture of chinaware, porcelain, and refractories. In the paper-coating industry, the kaolin is mixed with the cellulose fiber in the paper sheet. This gives the paper its color, opacity, and printability. It is also used as a pigment additive in paints, as a filler in plastic and rubber compounds, and in pharmaceuticals.

6 0
3 years ago
Wax melts when it is heated. Which most likely describes what is true of the result of this reaction?
andre [41]
<span>The same amount of wax exists before and after the change.

Wax when melted will be like liquid. Liquid has no definite shape, but definite volume.</span>
4 0
3 years ago
What should you do do prepare for a Matter test?
GuDViN [60]

Answer:

get a cheat sheet like fr

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • planet x is a terrestrial planet in our solar system it has 21% oxygen in its atmosphere humans can walk on this planet without
    5·2 answers
  • In contrast to adults, cardiac arrest in children is usually caused by
    6·1 answer
  • Researchers have demonstrated that organic farming ________. is only sustainable with pesticides and synthetic fertilizers prese
    15·1 answer
  • Miles wants to write the equation for photosynthesis. The diagram below represents one of the molecules in the equation.
    7·1 answer
  • In his attempt to develop a pneumonia vaccine, Frederick Griffith injected mice with various combinations of living and dead bac
    11·1 answer
  • Record your answer from lab exercise #1, step 1, question 1.what time in hours:minutes:seconds gmt did the p waves arrive?
    12·1 answer
  • Use the following information to answer the question.
    12·1 answer
  • In this food web, the ____________ is the primary consumer and a herbivore. a shrew b red fox c willow tree d snowshoe rabbit
    14·1 answer
  • Hypertonic solutions have ______ water potential.
    5·2 answers
  • Latitude and Longitude fill in the blanks
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!