Answer:
premarket tobacco application (PMTA) is an application that must be reviewed and approved by the Food and Drug Administration before a new tobacco product can be legally marketed in the United States.
Explanation:
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
the structure by which the embryo is called the oblica cord
The Gecko. While human-made devices inspired by gecko feet have emerged in recent years, enabling their wearers to slowly scale a glass wall, the possible applications of gecko-adhesion technology go far beyond Spiderman-esque antics. A researcher is looking into how the technology could be applied in a high-precision industrial setting, such as in robot arms used in manufacturing computer chips.
