1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
6

Which cell type is not found in connective tissue?

Biology
2 answers:
snow_tiger [21]3 years ago
6 0

Answer:

Basement membrane

I hope this helps!

Artemon [7]3 years ago
4 0

Answer:

A basement membrane

Explanation:

You might be interested in
How is carbon moving between the air and found it decreasing in the  diodome
scoray [572]

Answer: They read articles about photosynthesis. They investigate photosynthesis, energy storage molecules, and carbon in the sim. ... This process moves carbon from biotic to abiotic matter. Carbon dioxide in the biodome decreased because decomposers decreased which means there was a decrease in cellular respiration overall.

Explanation:

6 0
3 years ago
What is speciation a result of
erik [133]

The first one is correct

3 0
3 years ago
I need help on 6,7,8 thank you i wrote on it sorry
lara31 [8.8K]
6. is Saprophytic

7. Parasitic

8. Either mimetic or mutualistic i think mutualistic
3 0
3 years ago
8. At the 5th trophic level would be ___ consumers that eat ___ consumers. I need to fill in the blanks.​
sattari [20]

Answer:

At the 5th trophic level would be <em>quaternary</em> consumers that eat <em>tertiary </em>consumers.

Explanation:

Producers include photosynthetic organisms such as plants and algae.  They are eaten by primary consumers (herbivores).  Secondary consumers include omnivores and predators that prey on primary consumers.  Tertiary consumers include omnivores and predators that prey on primary and secondary consumers.  Quaternary consumers include omnivores and predators that prey on all lower trophic levels.

4 0
2 years ago
Which tool is used to measure an objects mass??
Vesna [10]

A Balance tool is what you need                              

7 0
3 years ago
Read 2 more answers
Other questions:
  • In humans, the gene for normal color vision, C, is dominant to the gene for red-green colorblindness,c; this trait is sex-linked
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What are the four chambers of the heart
    12·1 answer
  • What question is most likely related to the field of biology
    13·1 answer
  • Biological organisms are called carbon based life forms because the basic molecular structures holding everything together are m
    14·1 answer
  • Help <br><br> someone that knows it
    13·1 answer
  • Which algebraic property could be used to rewrite 3x ⋅ (7y ⋅ 4) as (3x ⋅ 7y) ⋅ 4?
    14·1 answer
  • How is UV light sensitive yeast related to the cell cycle/mitosis? please help!!!?
    9·1 answer
  • What factors are examined by the field of demography? check all that apply.
    10·1 answer
  • In a properly executed Gram stain, Gram positive organisms appear ________ while Gram negative organisms appear ________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!