1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
11

Predict the next digestive system organ in the following sequence:

Biology
1 answer:
mash [69]3 years ago
7 0

mouth

pharynx

esophagus

stomach

small intestine

large intestine

rectum

anus

You might be interested in
How does the bridge type determine the total length it can cross?
Virty [35]
How a bridge is built at the base can affect how far it can extend.
3 0
3 years ago
What happen if your body don't got no cell
adell [148]
That isn't even possible. Your body is made of them. If you had none then you wouldn't be existing.
5 0
3 years ago
Read 2 more answers
Which of the following is an example of a uniaxial joint?
Marysya12 [62]

Answer:

B . The hinge joint of the elbow.

Explanation:

Uniaxial joint allows for motion in a single phase.

8 0
3 years ago
Incorporation of _____, a neutral antibiotic, into a polyvinyl chloride membrane allows for the manufacture of an ion-selective
Alja [10]

The incorporation of valinomycin, a neutral antibiotic, into a polyvinyl chloride membrane allows for the manufacture of an ion-selective electrode that is highly selective for potassium.

<h3>How Valinomycin Ionophores Enter and Transport K+ across Model Lipid Bilayer Membranes?</h3>

  • A biomimetic lipid membrane attached to the surface of the gold electrode contained the cyclic peptide valinomycin.
  • The ionophore characteristics of the peptide were investigated using electrochemical impedance spectroscopy, and the conformation and orientation of the antibiotic valinomycin within the membrane were identified using polarization modulation infrared reflection absorption spectroscopy.
  • By forming a complex with potassium ions and an ion pair with a counter anion, valinomycin transports ions across the membrane, and the combination of these two techniques revealed novel information about the ionophore mechanism.
  • The ion pair is located inside the hydrophobic portion of the membrane and makes a little angle of around 22° with the surface normal.

To learn more about Valinomycin refer to:

brainly.com/question/13977514

#SPJ4

5 0
2 years ago
This bat drinks from<br> the plant. How is the bat<br> also helping the plant?<br> The bat spreads
Katena32 [7]

Answer:

the bat spreads the flowers pollen

8 0
3 years ago
Read 2 more answers
Other questions:
  • In order for biological evolution to occur, the environment would have to change drastically. True False
    11·2 answers
  • To protect endangered species from becoming extinct, it’s highly recommended to raise the animals in protected areas such as zoo
    13·1 answer
  • An asynchronous culture is given 3H-thymidine for a period of time, usually about 30 minutes. During the labeling period, 42% of
    7·1 answer
  • If a strand of DNA has 24% T, what percent will be G?
    11·2 answers
  • Describe earliest land plants
    12·1 answer
  • Some plants respond to light with a sudden enlargement of their leaf pores. This response is important because it enables the pl
    6·1 answer
  • Urgent needs an answer now!!!!!!!!!!!!!!!!!!!! Why does it take several redox reactions in a cell to make water from hydrogen an
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • As a scientist, what are some questions you could answer with a microscope but not with your eyes alone?
    13·1 answer
  • among the typical midlife changes for men are a(n) . a. loss of body fat b. increase in testosterone production c. increase in p
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!