The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG
The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
Answer:
They never promote the negative side effects on drinkers
Explanation:
Anti- inflammatory combined with a local anesthetic that offers short term pain relief for degenerative disc disease. So a positive effect , in some cases saline can flush out chemicals that can cause the inflammation providing even more pain relief.
The statement is true. Dead zones are the zones of oxygen depletion, which is caused by excessive running off of the fertilizers into the water body. These chemicals, particularly the nitrates, which are used by algae etc. which bloom by using the nitrates and use the oxygen present in the water. When they die, oxygen levels become critically low till then, for other aquatic animals like fishes etc., to survive.
Answer:
double fertilization
Explanation:
Flowering plants or angiosperms are seed-producing plants with the ability to produce reproductive organs-flowers and fruits with seed in it (unlike gimnosperms which contain naked seed). Another distinctive feature of angiosperms is their reduced gametophytes. This feature most likely reduces the time between pollination and fertilization. Fertilization in flowerin plants is double, meaning that two sperm cells fertilize ovule cells(egg cell and central nuclei cell): one forms diploid zygote which will develop in embryo, while other form triploid cell which will develop into endosperm (provides nutrition for the embryo).
