1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
15

Two equal body masses are accelerated, but body a's acceleration one-fourth of body b's. what is the force of body b on body a

Biology
1 answer:
Bad White [126]3 years ago
6 0
Body b will have a force 4 times stronger than body a, causing body b to reverse the direction of body a
You might be interested in
What is the difference between sedimentary and metamorphic rock?
Dmitry [639]
Metamorphic are formed through change underground sedimentary are formed through sediment
4 0
3 years ago
Read 2 more answers
Which two moods are used for situations that are contrary to fact or for the conditions under which a situation might occur? sub
EastWind [94]

The correct answer is: subjunctive and conditional.

Subjunctive mood – mood used for the expression of various states of unreality. This include the states such as wish, emotion, possibility, opinion..

Conditional – used for the expression of states: what could happen, what might have happened, and what we wish would happen..

7 0
3 years ago
Read 2 more answers
A woman has a baby that is type B blood and she has type O blood. There are two men that could be the father, one has type A and
Strike441 [17]

Answer:

the guy who is type O

Explanation:

using a punnet square you can come up with 4 seperate possiblitys for the baby's blood type. We don't know any of their recessive traits tho so im pretty sure its O. i could be wrong tho!

4 0
3 years ago
a solid is a substance a. that has a fixed shape and volume. b. that is invisible. c. that has a changing shape and volume. d. t
iVinArrow [24]
Answer: A; a solid has a fixed shape & volume
4 0
3 years ago
Read 2 more answers
The food web illustrated here exists in Yellowstone National Park,
kondor19780726 [428]

Answer:

Decreased biodiversity and increased red fox population

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which method would allow you to study the behavior of a tiger in its native habitat in India?
    11·1 answer
  • Ferns use the starch-filled cells of this structure for storage.
    15·1 answer
  • An example of a xerophyte would be _____.
    14·2 answers
  • The process by which lithospheric plates move apart creating spaces that are filled with hot magma is called _____.
    10·2 answers
  • Role of T helper cells in the specific immune response
    12·2 answers
  • How do mountains play a role in precipitation patterns like ?
    12·1 answer
  • Three physical forces are involved in glomerular filtration: glomerular capillary blood pressure, plasma-colloid osmotic pressur
    11·1 answer
  • Name the main chemical responsible for pollen tube growth
    11·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which of the following are true regarding ores?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!