1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vesna_86 [32]
2 years ago
12

Based on your knowledge of roots and affixes which is most likely definition of the word microscopic?

Biology
1 answer:
lisov135 [29]2 years ago
4 0

Explanation:

Microscopy is the science of investigating small objects and structures using a microscope. ... Microscopic means being invisible to the eye unless aided by a microscope.

You might be interested in
True or False: Matter on Earth is never lost. If an animal or plant dies, the matter in the animal or plant will be used over an
Pavel [41]

Answer:

True

that's just how it is

4 0
3 years ago
1) What is the scientific method?
Leviafan [203]
The answer to this question is B
4 0
2 years ago
If you have an eraser with a mass of 20g and volume of 10cm^3, what is the density
TEA [102]
Feel free to ask if you still don't understand

7 0
3 years ago
Which best describes transduction in bacteria
mrs_skeptik [129]

Answer:

Transduction is a process by which DNA is transferred from one bacterium to another by the action of a virus. It is also used to designate the process by which exogenous DNA is introduced into a cell by a viral vector. This is a tool that molecular biologists usually use to introduce a foreign gene in a controlled way into the genome of a recipient cell.

Explanation:

When bacteriophages (viruses that infect bacteria) infect a bacterial cell, their normal mode of reproduction consists in capturing and using the machinery of replication, transcription, and translation of the recipient bacteria cell to produce large numbers of virons, or produce particles. viral, including viral DNA or RNA and protein coat.

3 0
3 years ago
Read 2 more answers
2. A mouse has the alleles aa and is albino. Identify<br> the genotype and phenotype of the mouse.
larisa [96]

Answer:

crab legs

Explanation:

8 0
3 years ago
Other questions:
  • What is the end result of meiosis
    7·2 answers
  • A person's skin cells and heart cells have a complete copy of all the person's chromosomes each cell however makes different typ
    6·1 answer
  • What are 4 features found olny in eukaryotic?
    10·1 answer
  • There's no right or wrong answer
    8·2 answers
  • Which statement best describes science?
    12·2 answers
  • How many genes make up the human genome?
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is formed by carbon by extreme pressure and heat?
    10·1 answer
  • Define the following :
    11·1 answer
  • Which statement best explains the shape of these layers of rock?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!