1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
6

A botanist wants to see how different colored light waves influence the growth of pea

Biology
1 answer:
S_A_V [24]3 years ago
4 0

Answer:

write the procedure in the passive voice (reporting fashion )

You might be interested in
A 40 year-old woman who is 25 weeks pregnant with her second child, is seeing her obstetrician. she is worried about decreased f
AveGali [126]

The answer is O76, O09.522, Z3A.25 code. Fetal bradycardia is defined as a baseline fetal heart rate less than 110 beats per minute for at least 10 minutes. ICD-10-CM) is a system used by physicians and other healthcare providers to classify and code all diagnoses, symptoms and procedures recorded in conjunction with hospital care in the United States.

3 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What is another word for microbial cells
Solnce55 [7]
Bacteria cells, I believe so.
6 0
3 years ago
Read 2 more answers
What might happen if cells divide uncontrollably
Luba_88 [7]
<span>When cells divide uncontrollably, then there is a huge number of them and they take up most of the space in the body. Thus, lumps start to appear on and in a person's body, on organs and skin, and these lumps often represent cancer. So, uncontrollable division of cells can lead to cancer. Hope this helps. Let me know if you need additional help!</span>
6 0
3 years ago
How is energy converted in a hydroelectric plant?
olga55 [171]
C, if you look at a water wheel, water flows on the wheel, turning a rod, powering something on the inside. Dams do the same thing except the rod goes into a transformer and is more complicated.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which example describes an acquired trait that cannot be determined by looking at an individual?. . A.. skin color. . B.. body s
    9·2 answers
  • The largest region of the brain
    9·1 answer
  • Mammary glands are a shared characteristic among mammals and the oldest common ancestor of mammals. This is an example of a
    7·2 answers
  • Describe the structure of the cell membrane and describe its components.
    14·1 answer
  • Which statement best describes geothermal energy?
    14·1 answer
  • Which did Alisha place in the wrong column? - Density: 11.34 g/cm3 -Soft
    15·2 answers
  • 6. A pink snapdragon is crossed to a white snapdragon. What is the probability of getting a red snap dragon
    5·1 answer
  • When you ride in your car and the trees and buildings appear to you to move backward, you are observing motion.
    14·1 answer
  • Using the 100x objective lens from question 6, you estimate 12 organisms could fit across the DFV if they were laid end-to-end a
    6·1 answer
  • In a pcr reaction, the strands of dna are first separated by ___.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!