1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
3 years ago
12

how do you think earths large temperature gradient affects the speed of its convection currents how would this speed change if e

arths core was cooler
Biology
1 answer:
dezoksy [38]3 years ago
7 0
A higher temperature gradient causes faster heat transfer, and thus faster convection currents. If the core were cooler, the temperature gradient would be lower, so the convection currents would likely slow down.
You might be interested in
What is the earth?<br> What is the atomosphere
ruslelena [56]

Answer:

Earth's atmosphere is a layer of gases surrounding the planet Earth and retained by the Earth's gravity.

Explanation:

It contains roughly 78% nitrogen and 21% oxygen 0.97% argon and carbon dioxide 0.04% trace amounts of other gases, and water vapor. This mixture of gases is commonly known as air.

8 0
3 years ago
Read 2 more answers
Which of the following is not apart of cell theory
kicyunya [14]

Answer:

the cell theory is:

1. all organisms are made of cells

2. all cells are produced by other living cells

3. the cell is the most basic unit of life

6 0
3 years ago
when you perform a dihybrid cross with two heterozygous individuals for the two traits, what is the expected phenotypic ratio?
Sergeu [11.5K]

Answer:

9:3:3:1

Explanation:

A dihybrid cross tracks two traits. Both parents are heterozygous, and one allele for each trait exhibits complete dominance *. This means that both parents have recessive alleles, but exhibit the dominant phenotype. The phenotype ratio predicted for dihybrid cross is 9:3:3:1. (There's a calculator on google that show the outcomes just to let ya know) hope it's correct .

8 0
3 years ago
Read 2 more answers
Which best illustrates the result of the process of meiosis?
yulyashka [42]

Answer:

thanks so much g

Explanation:

........

6 0
3 years ago
What is the main functions of lipids?
Firdavs [7]
Stores energy within the body also in animals it is to store energy
5 0
3 years ago
Read 2 more answers
Other questions:
  • Mendel wanted to find out if the color of the seed of a pea plant affected the seed shap what experiment did he perform to test
    8·1 answer
  • Which division of the peripheral nervous system is responsible for producing physiological symptoms (such as increased heart rat
    10·1 answer
  • The image below shows a club fungus. A club fungus has an erect, above-ground fruiting body and long, branching, underground hyp
    11·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • What is the difference between prokaryotic and eukaryotic cells​
    12·1 answer
  • Put in order from smallest to largest<br> Solar system,stars,planets,Universe,galaxy
    7·2 answers
  • 1) When a fluid is heated it increases in temperature and it's molecules
    7·2 answers
  • What are the proper techniques to preserve viable semen?
    11·1 answer
  • What season is it in Buenos Aires when it is winter in Boston, Massachusetts? Winter Summer Spring Autumn
    8·2 answers
  • PLEASE HELP ME (NO LINKS)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!