1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jet001 [13]
3 years ago
15

Mesopotamians gave offerings and animal sacrifices to the gods so that *

Biology
1 answer:
Sonja [21]3 years ago
7 0

Answer:

the gods would influence nature to help them

Explanation:

The animal sacrifices were made to the gods so that the gods would influence nature to help them. They believed that when things were going bad for them such as crops not growing, or rain not falling for an extended period of time, it meant that the gods were angry. In order to please them, the Mesopotamians would sacrifice an animal in the name of their gods to please them. They believed if the gods were happy they would influence nature to help produce food in their lands so that they can harvest and survive.

You might be interested in
The enzyme acetylcholinesterase causes acetylcholine to
tatiyna

Answer:

A) decompose.

Explanation:

  • Acetylcholine is a neurotransmitter that acts at the neuromuscular junction and activates the muscles.
  • The neurotransmitter acetylcholine is hydrolyzed by the enzyme acetylcholinesterase into choline and acetate.
  • Due to the activity of acetylcholinesterase, the acetylcholine does not remain for long in the synapses and thus, the synaptic transmission is terminated by the enzyme. 
3 0
3 years ago
_____ is a method of enhancing the efficiency of food use and lowering the metabolic rate of the body through successive cycles
irinina [24]

Answer:

yo- yo diet

Explanation:

Yo-yo diet is a method of cyclic loss of weight gain and loss which is called as yo-yo due to the up and down motion of a yo-yo.

In this type of diet the person who is dieting first looses the weight but then again gains it and then again goes on a diet to loose the gained weight.

In this type of dieting pattern a person initially starves and maintains a hypocaloric diet to enhance the efficiency of food use however, this starvation back fires as when the person starts eating again the tendency to eat more fatty food and high caloric intake increases.

5 0
3 years ago
What is nutrition ? ,,,,,,,,
yarga [219]

Answer:

Nutrition is the biochemical and physiological process by which an organism uses food to support its life. It includes ingestion, absorption, assimilation, biosynthesis, catabolism and excretion. The science that studies the physiological process of nutrition is called nutritional science.

3 0
3 years ago
Read 2 more answers
Which of these shows the correct hierarchical sequence?
kenny6666 [7]

Answer:

The correct answer is B ❤️

8 0
3 years ago
P S Q R The biological levels of organization range from a single organelle all the way up to the biosphere in a highly structur
rjkz [21]

Answer: the red thing pretend is blood and blue thing is water you first ta

Explanation:

8 0
3 years ago
Other questions:
  • Which of the following statements about the nucleus is true?
    5·2 answers
  • The most common type of workplace violence in healthcare settings is
    13·1 answer
  • The ________ of the immune system are designed to recognize foreign or harmful substances (antigens), such as
    7·1 answer
  • Which vascular plant organ is most dependent on surface area to carry out its<br> function?
    8·1 answer
  • How are a carrot, an amoeba, and a mandrill. alike
    10·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • -Which is the correct order from the first<br> process to last?
    6·1 answer
  • In a well-constructed paragraph, answer the question below.
    9·1 answer
  • Flow
    14·1 answer
  • Which statement is not consistent with Darwin’s theory of natural selection?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!