1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Temka [501]
3 years ago
14

If a cell has a high concentration of waste that it wants to get rid of, which do you predict will be able to get rid of the was

te sooner – a smaller cell or a large one? ​Explain your answer,​ make sure to use the following terms in your answer: plasma membrane​ and ​surface area to volume ratio​.
Biology
1 answer:
valina [46]3 years ago
8 0

Answer: smaller cell

Explanation:

You might be interested in
Insects are the most diverse group of organisms, in terms of numbers of species, dominating terrestrial habitats.
Igoryamba
It’s true, there are more insects than there are any other specie and more kinds
3 0
3 years ago
How do you clear your notifications.
netineya [11]
U just check a few of them and pretty much close the app then they should be cleared :)
8 0
3 years ago
Please help! c:
patriot [66]
I think I understand even without the picture. I'll add a picture of the Punnett Square filled in, but what you're crossing is

Tt  x  tt (heterozygous crossed with a homozygous recessive)

The ratio you get in the end is 2 heterozygous (Tt) and 2 homozygous (tt) offspring, so the ratio is 1:1.

So the percentage of offspring that are homozygous recessive is 50%.

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
There are a large number of antibiotics that inhibit protein synthesis at 70s ribosomes found in bacterial cells but do not inte
LekaFEV [45]

Answer:

C. These antibiotics interfere with protein synthesis within eukaryotic mitochondria.

Explanation:

Eukaryotic mitochondria have 70s ribosomes and is made up of 50s and 30s subunits which has similarities to the ribosomes of bacterial cells. This likeness

at times causes antibiotics that ought to be toxic to bacterial ribosomes to cause some toxicity in eukaryotic cells instead.

7 0
3 years ago
Other questions:
  • Choose all the answers that apply. Ecosystems _____. can be small can be large are made of biomes only have living parts have no
    10·1 answer
  • The harmonic motion of a boy on a swing is like the motion of a(n) _____
    7·1 answer
  • Cellulose-digesting microorganisms live in the guts of termites and ruminant mammals. the microorganisms have a home and food, a
    10·1 answer
  • Scientists often replicate the experiments that other scientists have already performed. That is, they reproduce an experiment b
    13·1 answer
  • What is a source of atmospheric co2
    9·1 answer
  • In a cell with defective chaperones, Question 14 options: proteins would not be able to exit the ribosome. the concentration of
    12·1 answer
  • How are lysosomes pro-nuclear dense bodies?
    9·1 answer
  • Which of the following is a source of genetic variation in sexually-reproducing organisms? A-meiosis B-Mitosis C- Translation D-
    9·2 answers
  • The normal shape of an enzyme is as shown in structure A. If the enzyme's shape changes to that shown in structure B, what are t
    15·1 answer
  • Name two types of a sexual
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!