1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
3 years ago
5

Which term refers to the number of protons in an atom of an element?

Biology
2 answers:
mart [117]3 years ago
8 0

Answer:

The answer is "Atomic Number"

Explanation:

posledela3 years ago
7 0
The atomic number where as the atomic mass refers to the number of both neutrons and protons and the symbol refers to the element
You might be interested in
Please help me with this question
pishuonlain [190]

Answer:

So this is just a guess but i think its D but like I said its a guess.

3 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
When matter from plants and animals decay, microorganisms responsible for the decomposition process respire. Is that photosynthe
n200080 [17]
In Nature's rule of law; it is technically both. The only difference between the two would be photosynthesis happens with plants. While cellular respiration happens with living beings.
8 0
3 years ago
Read 2 more answers
Name any two body systems in the human body and name at least one function of each system
Dmitriy789 [7]
<span>Cardiovascular / Circulatory system: ...Digestive system / Excretory system: ...Endocrine system: ...Integumentary system/ Exocrine system: ...Lymphatic system / Immune system: ...Muscular system/Skeletal system: ...Nervous system: ...<span>Renal system / Urinary system:</span></span>
4 0
3 years ago
How did Alfred Wegener use rock and fossil evidence to support his hypothesis of continental movement.
LuckyWell [14K]
Fossils and rocks identical to each other wet found on separate continents because rocks and the animals that formed those fossils can't swim the logical explanation was that the continents split after the rocks and fossils were formed
7 0
3 years ago
Other questions:
  • Which part of a plant cell is responsible for converting light energy into chemical energy?
    13·1 answer
  • What molecule does carbon start out in
    12·1 answer
  • How does a sex cell differ from a body cell
    9·2 answers
  • DNA will condense into
    8·2 answers
  • What is made up of fossils
    6·2 answers
  • Which of the following statements is true?
    10·2 answers
  • Put the following mitosis and cytokinesis images in order.
    13·1 answer
  • Suggest me best subject for invertibrate for presentation​
    8·1 answer
  • Where do the thickest deposits of terrigenous sediment typically form?
    15·1 answer
  • Muscles are named according to their:____________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!