Answer:
In sexual reproduction, two parents are required to produce a new organism. Most plants and animals, including human beings, reproduce sexually
2. the production of new organism by combining genetic information from two individuals of different types (sexes). in most higher organisms, one sex (male) produces a small motile gamete which travels to fuse with a larger stationary gamete produced by others (female).
The slide of stages in starfish development illustrates stages from unfertilized egg to gastrula—typical of echinoderms and chordates that have very little yolk in the egg. Three embryonic cell layers—ectoderm, endoderm, and mesoderm—are established. All adult tissues are derived from these layers.
Answer:
The history of Earth covers approximately 4 billion years (4,567,000,000 years), from Earth's formation out of the solar nebula to the present. Earth formed as part of the birth of the solar system: what eventually became the solar system initially existed as a large, rotating cloud of dust and gas.
Explanation:
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
