1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
3 years ago
7

What appears to happen to the moon as it goes through its cycle?

Biology
1 answer:
anygoal [31]3 years ago
6 0

Answer: It appears to change shape.

Explanation: As the moon rotates around the Earth, sunlight hits only part of the moon, making it look like it changed its shape.

You might be interested in
Which of the following is a good way to analyze data?
liubo4ka [24]
C. Organize it into charts, graphs, do calculation if necessary.
5 0
2 years ago
Read 2 more answers
In a series of 250 base pairs there are 28 guanine. How many adenines are there?
arsen [322]

Answer:

278

Explanation:

Because How Many Is A Keyword

3 0
3 years ago
Read 2 more answers
Water molecules exhibit a property by virtue of which they can stick to each other. What is this property referred to as?
lisov135 [29]
Its referred to as <span> cohesion</span>
3 0
3 years ago
Read 2 more answers
The vaccine for chickenpox is: select one:
Alexxandr [17]
C. alive. The vaccine contains a live strain of varicella-zoster (chicken pox) virus which has been attenuated so that it will stimulates the immune system but does not cause any disease in healthy people.
5 0
3 years ago
Which of these phases is Anaphase? <br><br><br>​
djverab [1.8K]

Answer:

C the second picture

Explanation:

  • <u>Anaphase</u> is the stage of mitosis after the process of metaphase, when replicated chromosomes are split and the newly-copied chromosomes (daughter chromatids) are moved to opposite poles of the cell. Chromosomes also reach their overall maximum condensation in late anaphase, to help chromosome segregation and the re-formation of the nucleus.
4 0
3 years ago
Other questions:
  • EXPLAIN the difference between qualitative and quantitative data. Give examples to support your responses.
    7·2 answers
  • Why you do sometimes shiver when you're cold?
    15·1 answer
  • True or false electron microscopes have much higher magnification than compound light microscopes ​
    5·1 answer
  • Between your evening meal and breakfast, your blood glucose drops and your liver becomes a net producer rather than consumer of
    6·2 answers
  • Which metamorphic process usually produces foliated rocks?
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which statement about gene expression is TRUE?
    12·2 answers
  • Which statement is supported by the diagram?
    10·1 answer
  • PLEASEE
    10·1 answer
  • Where would you find a strong acid on the pH scale?<br> A. 1<br> B. 5<br> C. 3 <br> D. 13
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!