1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iragen [17]
3 years ago
10

How do people tend to use land as the human population increases? Human and environment

Biology
1 answer:
ratelena [41]3 years ago
6 0

Answer:

The growing population demands more food and more land for their needs. As it increases, more land is used for building houses and factories.

Explanation:

You might be interested in
Help please and thank you
Anna [14]

Answer:

i think its D

Explanation:

5 0
3 years ago
Read 2 more answers
Soo-Jung used the subtraction property of equality to solve an equation for y. Which equation could be the one that Soo-Jung sol
antiseptic1488 [7]

Explanation:

Option 1.

4y=12

Dividing 4 both sides

y=3

Division property should be used.

Option 2.

\dfrac{y}{4}=12

Cross multiplying each other,

y=12(4)

y=48

Option 3.

2(4y)=12

Opening bracktet in LHS

8y=12

Dividing both sides by 8 i.e.

y=\dfrac{12}{8}\\\\y=\dfrac{3}{2}

Division property is used.

Option 4.

y+4=12

Subtracting both sides by 4 i.e.

Y+4-4=12-4

y=8

Subtraction property is used.

<em><u>It means that in option (4) Soo-Jung used the subtraction property of equality to solve an equation for y.</u></em>

3 0
3 years ago
Read 2 more answers
Helpppppppppppppppppppppppppppppppppppppppppppppppppppp
sveta [45]

corona is a

Photophere is C

radiative zone is D

chromophere is B

4 0
3 years ago
Our Sun has a surface temperature of about 9000 degrees Celsius, and is G2 Star.
Ksenya-84 [330]

Answer:

Sun is classified as a G2 V star, with G2 standing for the second hottest stars of the yellow G class of surface temperature about 5,800 kelvins (K) and the V representing a main sequence, or dwarf, star, the typical star for this temperature class.

8 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Other questions:
  • although Darwin did not realize it, the variations he observed among the individuals of a population of finches were caused by w
    9·1 answer
  • How did you go about implementing the lab activity?
    6·1 answer
  • Imagine that you are a research chemist who wishes to develop a chemical adhesive that will work under water. Which of the follo
    7·1 answer
  • What effects did the introduction of the nutria have on ecosystems throughout the U. S.?
    15·1 answer
  • In Mendel's experiment, why did traits show up in the F2 generation that were not present in the F1 generation? A.The traits wer
    11·2 answers
  • How do I know when eclipses occur....please help me
    13·2 answers
  • Which of the following is a natural change to the balance of nature?
    5·2 answers
  • How long does adaptation usually take? (Plant)
    8·1 answer
  • What are some things that have glucose in it?
    8·1 answer
  • 3. The table below shows factors that could be present in a population. Next to each factor,
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!