1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
3 years ago
14

How do colorful flowers and sweet smell disperses seeds

Biology
1 answer:
Andrej [43]3 years ago
3 0

Answer:

The study found the fruit-bearing plants had evolved to cater to the visual capabilities of the main seed-dispersing animals in each place.

Explanation:

You might be interested in
A plate boundary where an ocean plate collides with a continental plate forms _________
SOVA2 [1]

Answer:

When the plates are at the mid ocean ridges thay are spreading apart creating new ocean floor. this is also called a divergent boundary

5 0
3 years ago
Read 2 more answers
Right below-the-knee amputation with the residual limb elevated on a pillow to prevent edema. in which position should the nurse
Fed [463]
The answer is for short periods in the prone position. Hope this helps.
4 0
3 years ago
In figure 32-3 a muscle that moves food through your digestive system is shown in
Levart [38]
<h3><u>Answer;</u></h3>

B

<h3><u>Explanation;</u></h3>
  • B are smooth muscles.
  • Smooth muscle is found in the walls of hollow organs throughout the body.
  • Smooth muscle contractions are involuntary movements triggered by impulses that travel through the autonomic nervous system to the smooth muscle tissue.
  • <u>The smooth muscle of the alimentary canal or the digestive tract facilitates the peristaltic waves that move swallowed food and nutrients.</u>
4 0
3 years ago
Read 2 more answers
What do the circled arrows in the image indicate?
Fudgin [204]

Answer:

CO2 released to the atmosphere

Explanation:

8 0
3 years ago
What other body systems are related to the digestive system
nika2105 [10]

The digestive system enlists the aid of the cardiovascular system and the nervous system. Blood vessels of the digestive system widen to transport more blood.

8 0
3 years ago
Other questions:
  • Barometric pressure has been dropping all day. What weather conditions will most likely occur?
    12·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A gene that masks the expression of a second gene is
    6·1 answer
  • What element do nucleotides possess but proteins do not​
    7·1 answer
  • What is the molecular formulas for penicillin, adenosine triphosphate, cholesterol, testosterone, and phenylalanine.
    10·1 answer
  • How many neutrons does a typical neon atom have?
    6·1 answer
  • This diagram shows the process of translation. Which statement is correct?
    15·1 answer
  • Match these items.
    10·1 answer
  • Glutamate is the neurotransmitter released at the rod-bipolar cell synapse. When there is light, the rod membrane potential will
    15·1 answer
  • Which epithelium is best suited for resisting abrasion and preventing pathogen entry into deeper tissues?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!