1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Charra [1.4K]
2 years ago
5

This macromolecule forms pumps and channels within the cell membrane. They act like to let molecules in and out of the cell.

Biology
1 answer:
Ilya [14]2 years ago
3 0

Answer:

The macromolecules that forms pumps and channels in the cell membrane, allowing the entry and exit of molecules to the cell are protein.

Explanation:

Membrane integral proteins are a type of macromolecule attached to the structure of the membrane and have ends in contact with the cytoplasm and the extracellular medium.

These <u>protein molecules can act as channels and transporters or pumps</u>, to facilitate the passage of substances through the membrane. An example of transmembrane channels are ion channels, while a protein transporter is the sodium potassium ATP-ase pump.

Membrane proteins can also act as surface receptors and enzymes linked to the cell membrane.

The other options are not correct because :

  • <em><u>Carbohydrates</u></em><em> can be found on the membrane bound to other molecules, such as glycoproteins and glycolipids, but they do not act as pumps or channels. </em>
  • <em><u>Lipids</u></em><em> have the function of being the main component of the cell membranes. </em>
  • <em><u>Nucleic acids</u></em><em> are found in the nucleus, and are not part of the cell membrane.</em>
You might be interested in
True or faulse organic fat will not dissolve in water
Alika [10]
False. It can and will dissolve in water.
5 0
2 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
1. What evidence supports the notion that sponges are some of the earliest known multicellular animals?
Serga [27]

<u>Answer:</u> "Chemical fossils"evidence supports the notion that sponges are some of the earliest known multicellular animals.

<u>Explanation:</u>

Sponges are multicellular animals, may belong to Ediacarian period likely to be 80 million years ago or earlier. They catered through a complex system of internal channels, by moving seawater.

Sponges are soft-bodied and very rarely protected as fossils, therefore finding evidence of existence is giant task. The key of their existence came to know from abnormal chemicals which is a steroids of a particular type generated sufficiently by them but virtually never by ordinary organisms.

Analysis of long strata sequence found in Oman and researchers have been able to extract these "chemical fossils" from samples spanning tens of millions of years — before, during and after the Ediacarian period.This gave clear evidence that sponges had to have evolved long before the great variety of multicellular organisms proliferated at the dawn of that time.

8 0
2 years ago
Which of the following do scientists use to reinforce the integrity of their scientific investigations and reported data? I. exp
MissTica
Publication in journals
you see that a lot today
<u>Hugs ~L</u>
4 0
3 years ago
A knight pushes a boulder for 15m using a force of 200N. How much energy did the knight transfer?
TiliK225 [7]
Work done= <span>force x distance moved in the direction of that force so: 200 x 15 = 3000J=4kJ</span>
8 0
3 years ago
Other questions:
  • A derived unit is a combination of fundamental units what is an example of a derived unit
    9·2 answers
  • A couch potato eats lots of pizza, chips, and hamburgers and never exercises, and develops arteriosclerosis, which includes hard
    12·1 answer
  • 1 )Which of the following is a possible formula unit? PbO Li2B Al2Pb3 ClO
    15·1 answer
  • True or False: When carbon dioxide is released into the atmosphere from
    14·2 answers
  • Compare clonal selection to a phosphorylation cascade that occurs in a signal transduction pathway. How are they similar to one
    6·1 answer
  • Imagine that you are the scientist who discovered cells. If you were to give a speech to a group of fellow scientists, what key
    7·2 answers
  • In your own words, what is the definition for Chitin?<br><br> what purpose does chitin serve?
    15·1 answer
  • What type of succession is shown in the picture?
    11·2 answers
  • This is one strand of the DNA sequence: ATGAC. What will be the new<br> strand after replication? *
    10·1 answer
  • PLEASE HELP ME!!! WILL GIVE BRAINLIEST!!!
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!