False. It can and will dissolve in water.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
<u>Answer:</u> "Chemical fossils"evidence supports the notion that sponges are some of the earliest known multicellular animals.
<u>Explanation:</u>
Sponges are multicellular animals, may belong to Ediacarian period likely to be 80 million years ago or earlier. They catered through a complex system of internal channels, by moving seawater.
Sponges are soft-bodied and very rarely protected as fossils, therefore finding evidence of existence is giant task. The key of their existence came to know from abnormal chemicals which is a steroids of a particular type generated sufficiently by them but virtually never by ordinary organisms.
Analysis of long strata sequence found in Oman and researchers have been able to extract these "chemical fossils" from samples spanning tens of millions of years — before, during and after the Ediacarian period.This gave clear evidence that sponges had to have evolved long before the great variety of multicellular organisms proliferated at the dawn of that time.
Publication in journals
you see that a lot today
<u>Hugs ~L</u>
Work done= <span>force x distance moved in the direction of that force so: 200 x 15 = 3000J=4kJ</span>