1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alisha [4.7K]
3 years ago
9

What is true about the heterozygous sickle-cell (HbA HbS) condition?

Biology
2 answers:
andrew-mc [135]3 years ago
5 0
It’s 4 none of the above
kozerog [31]3 years ago
3 0

Answer:

sickle cell anemia is not expressed

Explanation:

You might be interested in
A solar system has the five planets shown below. The mass of each planet is proportional to its size. Planet X is at equal dista
goldenfox [79]

Answer:

The answer is "planet C"

Explanation:

The answer would have to be C because of the mass of the planet, some people would say that is not exactly true in a lot of cases but in your problem the planet with the most gravitational exert would have to be planet C .One last thing you should know...'the Universal "LAW" of gravitation'. Laws/Principles can only be verified and cannot be proved. Laws are conclusions based on experiments.

3 0
4 years ago
Approximately how many gallons of water are used per year in a typical home? 1 million gallons 500,000 gallons 150,000 gallons 1
Advocard [28]

146 gallons of water

<h2>Further explanation </h2>

The human need for water (for drinking) is 8 glasses a day or about 2 liters. 1 gallon usually contains 19-20 liters. One house usually consists of 4 people <em>(father, mother, brother, sister). </em>

If one person consumes 2 liters of water, then one house will consume about 8 liters a day.

Which will take up 2 gallons in 5 days.

1 Year = 365 days

365 days : 5 days <em>(2 gallons)</em> = 73 <em>(gallon water refill frequency) </em>

73 x 2 = 146

So, within 1 year the level of gallon water consumption in an ordinary house consumes 146 gallons of water.

That is the calculation of the use of gallons for consumption, <em>not for bathing, washing, pooping, urinating, etc. </em>

Learn More

water consumption level brainly.com/question/8368059

gallon refill frequency brainly.com/question/8368059

Details

Class: High School

Subject: Biology

Keywords: gallons, water consumption, liters

6 0
4 years ago
Read 2 more answers
Which is a false statement about viniger
Arada [10]
Vinegar is a base could be a false statement about vinegar as vinegar has a PH of 2.4 and is highly acidic. 
4 0
4 years ago
In the diagram of the human digestive system, what organ is labelled 5?
il63 [147K]

Answer:

The large intestine

Explanation:

The large intestine is a long, tube-like organ connected to both the small intestine and the anus. In an anatomy drawing, it looks almost as if it is wrapped around the small intestine.

As we can see in the drawing, the organ labelled with 5 is wrapped around another organ which is smaller and looks longer. This smaller organ is the <em>small intestine</em>. Since we know that the large intestine <em>wraps around</em> the small intestine, we can infer that the organ is the large intestine.

Hopefully that was helpful! :)

8 0
2 years ago
When a tick transfers Lyme disease from a deer to a human, the tick is considered the ________ in the chain of infection
melisa1 [442]

The tick is considered the vector in the chain of infection.

Generally, vector organisms are organisms that are capable of transmitting disease pathogens from infected organisms to uninfected ones either directly or indirectly as a result of their activities.

Ticks are parasites that feed on the blood of vertebrate animals such as deers and humans. When they feed on the blood of animals with certain infections, the pathogens for such infections are sometimes carried in the guts of the parasites and these are transferred to the bloodstream of the next animal that would be their host.

A good example of this is Lyme disease.

More about vectors can be found here: brainly.com/question/12596213?referrer=searchResults

5 0
3 years ago
Other questions:
  • How do introduced species become established in a new ecosystem? Check all that apply. introduced to a habitat similar to their
    5·2 answers
  • How is human dna prepared for use in gene transfer?
    10·1 answer
  • How do drugs of abuse affect the brain?
    10·2 answers
  • Humans usually live in houses or other buildings that protect them from environmental hazards, such as rain, snow, and extremely
    8·2 answers
  • Choose the best explanation of the difference between evolution and natural selection.
    11·1 answer
  • During which process is energy released 1. external respiration 2. internal respiration
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What does Troph mean
    14·1 answer
  • Can I have help pls I do not understand this
    10·1 answer
  • Which part of the chemical structure differentiates one amino acid from another?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!