1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bogdan [553]
3 years ago
15

The process by which our sensory systems convert stimulus energies into neural messages is called

Biology
1 answer:
lesantik [10]3 years ago
6 0

Answer:

transduction

Explanation:

You might be interested in
Which is a difference between a compound light microscope and a transmission electron microscope?
Setler79 [48]

Answer:

Key Differences Between Light Microscope and Electron Microscope.

How I got it:

Following are the main differences between Light Microscope and Electron Microscope: Light Microscope uses visible light, and Electron Microscope uses electrons (beam of charged particles) to view the object.

7 0
3 years ago
A(n)
suter [353]

Answer:

Nutrient

Explanation:

Hope this helps!

3 0
3 years ago
What is a stimulus and response scenario that your body performs to maintain homeostasis?
Law Incorporation [45]
During body temperature regulation, temperature receptors in the skin communicate information to the brain (the control center) which signals the effectors: blood vessels and sweat glands in the skin.
5 0
3 years ago
Read 2 more answers
A jogger in July produces large amounts of sweat. Due to this the kidneys change the rate of urine production. Why is this impor
ivolga24 [154]
When it's hot or when the organism starts sweating a lot, this causes an amount of water to be lost from the body. Water is important for the organism to survive and it's absence wi lead to death, therefore Osmoreceptors cells in the hypothalamus in the brain, sends signals to increase the rate of water re-absorption by the kidney. This causes the urine to be of a low volume and more concentrated. This allows enough water to be used by the body as a lot has been lost during sweating.
7 0
3 years ago
At what stage of human development would you expect to first see a beating heart?
IRINA_888 [86]

at what stage of human development wuold you exept to first see abeating heart? <u>the</u><u> </u><u>answ</u><u>er</u><u> is</u><u> </u><u>ç</u>

6 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What are the three Domains of biological classification? A. Bacteria, Archaea, Eukarya B. Bacteria, Plantae, Animalia C. Plantae
    12·2 answers
  • What cell ontains chlophy11 a green pigment that trap senergy from sunlight and givves plants tot ehir green color?
    8·1 answer
  • Semester biology reveiw) Animals
    10·1 answer
  • Range on a pH scale for acid
    12·1 answer
  • Compare the productivities of a swamp and a river, and give two reasons for the difference
    11·1 answer
  • Judging from the information in the table, which of these stars is least likely to be categorized as a supergiant?
    12·2 answers
  • What is speciation?
    10·2 answers
  • Whats the relationship between an owl and mice could be described as?
    11·1 answer
  • For each of the following, circle the word that does not belong belong with the rest and then in ONE complete sentence, explain
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!