1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
3 years ago
10

What organisms receives the least amount of energy from the producer

Biology
2 answers:
Jlenok [28]3 years ago
7 0
“The top consumer of a food chain will be the organism that receives the least amount of energy.”
gregori [183]3 years ago
3 0
The top consumer of a food chain will be the organism that receives the least amount of energy
You might be interested in
1. Name 5 simple crochet stiches.
hjlf

Explanation:

Single Crochet Stitch.

Double Crochet Stitch.

Half Double Crochet Stitch.

Treble Crochet Stitch.

Slip Stitch Crochet.

3 0
2 years ago
Read 2 more answers
What is the name for a large region with consistent organisms and weather?​
Helga [31]

Answer:

a population or community.

Explanation:

7 0
3 years ago
What are two features that changed in the hominid skulls over time?
bija089 [108]

Answer:

The head got bigger and the face got smaller. Hope his helps.

5 0
3 years ago
A paramecium reproduces by dividing into two daughter cells. Which statement is true of the daughter cells?
Cerrena [4.2K]
This statement giving a clue that there is asexually reproduction (may be binary fission) taking place and the progenies in asexual reproduction are genetically similar to parent cell. So answer is A.
3 0
3 years ago
Patent fingerprints, or visible fingerprints, are left on a smooth surface when blood, ink, or some other liquid comes in contac
lana [24]

Answer:

Answer is option A (True).

Explanation:

The fingerprint pattern of an individual is unique as no two individuals have the same pattern and it remains unchanged. So fingerprints are considered as one of the main types of physical evidence that can be recovered from a crime scene for identification purposes.

The three types of fingerprint impressions are;

Patent fingerprints or visible fingerprints - They are visible prints that are left on a smooth surface of another object when foreign substances such as blood, ink, or some other liquid present on the skin of a finger come in contact with the surface. These prints are easily identifiable and are visible with the naked eye without any technological enhancements.

Plastic prints - They are visible, three-dimensional prints that are left on soft surfaces such as freshly painted surfaces or materials like wax, gum, clay, soap, etc when a finger comes in contact with that surface resulting in an indentation. These prints are easily observable and no enhancement is required.

Latent prints - They are invisible fingerprint impressions that are left on a surface as a result of the perspiration, moisture or oil found in the ridges of fingers. Since they are not visible to the naked eye, enhancement is required upon their collection.

8 0
3 years ago
Other questions:
  • A book that weighs 0.35 kilograms is kept on a shelf that’s 2.0 meters above the ground. A picture frame that weighs 0.5 kilogra
    12·2 answers
  • Which land formation is the result of a convergent boundary? A. central United States B. South American volcanoes C. Hawaiian vo
    15·2 answers
  • What is the definition of energy
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which is a function of the central nervous system? A. pumping blood through the body B. controlling coordination in the body C.
    13·2 answers
  • Before performing an mri, why must technicians ask patients if they have any steel inside their body?
    9·2 answers
  • Plz help I will mark you brainlist plz help ​
    14·1 answer
  • Why did Mendel remove the stamens of some pea plants during his first experiments? Select all correct answers.
    10·1 answer
  • TRUE or FALSE: Insulin and Glucagon
    10·2 answers
  • What characteristics do plants and animals have that increase their chances of reproduction?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!