Answer:
Sensory transduction.
Explanation:
Sensory transduction may be defined as the process by which sensory stimulus are transformed in the body. The receptor cell is mainly involved in the sensory transduction process.
The sensory receptor cell like a light or an odor is converted into the electrical signal by the process of signal transduction. The information is then conveyed to the nervous system in the form of electrical signals.
Thus, the correct answer is signal transduction.
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is
Explanation:
1. AACGTACGATCGATGCACATGCATGGCTACGC
Complementary strand
TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
Complementary strand
GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand
GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand
AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
Answer:
Despite a generally high security standard, <u>accidents can still happen.</u> It is technically impossible to build a plant with 100% security. A small probability of failure will always last. The consequences of an <u>accident would be absolutely devastating both for human being as for the nature.</u>
Nuclear power plants as well as nuclear waste could be<u> preferred targets for terrorist attacks. </u>No atomic energy plant in the world could withstand an attack. Such a terrorist act would have <u>catastrophic effects for the whole world.</u>
Oxidative phosphorylation requires a proton gradient.
- Cells use enzymes to oxidize foods in the metabolic pathway known as oxidative phosphorylation, electron transport-linked phosphorylation, or terminal oxidation, which releases chemical energy to create adenosine triphosphate.
- This happens inside mitochondria in eukaryotes. The majority of the energy required for biosynthesis, maintaining a healthy ion balance, and mechanical effort is provided by oxidative phosphorylation, which is the principal source of ATP in higher animals.
- A succession of proteins and electron carriers in the mitochondrial membrane, as well as the electron transport chain, are all involved in the process of oxidative phosphorylation.
learn more about Oxidative phosphorylation here: brainly.com/question/13254827
#SPJ4
INCOMPLETE DOMINANCE INHERITANCE:
<span>5. In Andalusian fowl, B is the gene for black plumage (head feathers) and B' (pronounced "B prime") is the gene for white plumage. These genes, however, show incomplete dominance. The heterozygous (BB') condition results in blue plumage. List the genotypic and phenotypic ratios expected from the following crosses: a) black x blue b) blue x blue c) blue x white</span>
<span>6. </span><span>In snapdragons, petal color is determined by a single gene locus with two alleles making the "red" allele (R) incompletely dominant to the "white" allele (r). Heterozygotes have petals, which are neither red nor white, but pink. a) If a true-breeding red flower is pollinated with pollen from a white flower: What fraction of the seeds (F1 generation) would be expected to produce red-flowered plants? What fraction of the gametes produced by the F1 plants would be expected to bear the R allele? b) If two pink flowered plants are crossed, what genotypic and phenotypic ratios are expected among the offspring (F1 generation)?</span>
