1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
White raven [17]
2 years ago
7

In 2015 what two space objects did New Horizons photograph?

Biology
1 answer:
GaryK [48]2 years ago
6 0

Answer: I think collecting data on Pluto and Charon (the Charon flyby was at about 17,900 miles or 28,800 kilometers), New Horizons also observed Pluto's other satellites, Nix, Hydra, Kerberos and Styx.Also In July 2015, NASA's New Horizons became the first spacecraft to visit dwarf planet Pluto. The far-traveling spacecraft also flew by an object called 2014 MU69, or Ultima Thule, in January 2019. Observations from New Horizons are revolutionizing our understanding of solar system objects orbiting far from the sun.

Explanation:

hope this helps have a great day ❤️❤️❤️❤️

You might be interested in
At what point during meiosis do homologous chromosomes pair up?
Readme [11.4K]

Answer:

Prophase 1

Explanation:

In prophase 1, homologous chromosomes pair up and exchange sections of DNA in a process called crossing over.

8 0
2 years ago
Read 2 more answers
Tamra is the goalie for her soccer team. The goalie blocks the ball from going into the net. She uses her brain, eyes, nerves, a
hammer [34]

Answer:

Her eyes send signals to the brain. Her brain gets the signal and sends another one through her nerves to her muscles. Her muscles then move her arm or leg toward the ball to try and block it.

Explanation:

Simple science. If I could help you, you are welcome. if I couldn't I'm sorry.

6 0
2 years ago
What are Mutualism, commensalism, Parasitism, and Predator-Prey?
Westkost [7]

Answer:

Explanation:

Mutualism - two organisms that benefit from each other

Commensalism - one organism benefits, one isn't harmed

Parasitism - a parasite benefits from and harms a host

Predator-Prey - a predator (animal that kills another for food) kills a prey (the animal it likes to eat) and eats it

5 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
The gamete produced in the ovary of an animal is the what?
Fantom [35]

Answer:

ovum

Explanation:

The ovum is produced from oogonia or ovum 'mother cells' through a process called oogenesis in the ovary. The ovum is not only among the largest cells of the body, it is also specialized to ensure accurate fertilization by exactly one sperm cell.

6 0
3 years ago
Other questions:
  • Pathogens _____.Rocky Mountain spotted fever is caused by
    8·1 answer
  • Which of the following is most likely to be an observation made by an anatomist?
    14·2 answers
  • In crocodiles, the sperm and egg combine inside the body of the female. Then the female lays the eggs, and the young develops ou
    14·2 answers
  • Which statements describe the effects of the solar wind on Earth? Check all that apply. The solar wind produces the northern and
    11·2 answers
  • In insects body fluids are are drawn into the?
    8·2 answers
  • The lower atmosphere is mostly warmed by radiated heat from Earth's surface. However, water heats up and cools down more slowly
    5·1 answer
  • Ted runs from the biology laboratory straight to his therapist's office. He is sweating and fear is etched on his face. He asks
    13·1 answer
  • What trophic level contains organisms that are the source of all chemical energy used in an ecosystem?
    14·1 answer
  • Which of the following statements is/are true concerning peptide bonds? They are the only covalent bond formed between amino aci
    8·1 answer
  • Do you think that tardigrades could hold the key to space travel. Why or Why not?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!