1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valkas [14]
3 years ago
13

¿Que tuvo en cuenta Oparin para desarrollar su modelo y que propone dicho modelo?

Biology
1 answer:
hammer [34]3 years ago
6 0

Answer:

Knowing others is intelligence; knowing yourself is true wisdom. mastering others is strength; mastering yourself is true power. if you realize that you have enough, you are truly rich, "And the cause of not following your heart, is in spending the rest of your life wishing you had."

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What structure of the sarcomere shortens during muscle contraction?
LiRa [457]

Answer:

The Z lines and H- zone shortens during the muscle contraction.

Explanation:

Sarcomere is the area between the two Z lines. The Z- lines are present in the centre of I - band and H - zone is present in the A - band. The actin filaments which are thin filaments present in I- band and contracts, slide over the myosin filament during contraction.

The I - band, H- zones are became shortens as they are thin than the A- band. It is anisotropic band having thick myosin filaments. They are not flexible and remain in its constant shape during the muscle contraction.

After the muscle contraction, the A- band and the H- zone comes to their original shape. In other words, the sarcomere shortens and comes back during muscle contraction, and relaxation.

3 0
3 years ago
Prokaryotes are now divided into the:
777dan777 [17]
<span>A) Archaea and Cyanobacteria is you answer im prity sure</span>
8 0
3 years ago
Gila monsters are very well adapted to their homes. They have thick skin to prevent water loss and they burrow to escape the hea
irina1246 [14]

Answer:The answer is Desert

Explanation:The dead giveaway is thick skin to prevent water loss and burrow to escape the heat.

7 0
3 years ago
Read 2 more answers
The first organ that sperm pass through is the __________. the first organ that sperm pass through is the __________. epididymis
mariarad [96]
<span>During ejaculation, the sperm is sent out from the epididymis into the deferent duct which then travels up the spermatic chord into the pelvic cavity. The first organ that sperm pass through is the epididymis ejaculatory duct . During this time rhythmic movements propel the sperm forward.</span>
8 0
3 years ago
Other questions:
  • The substance that initially traps solar energy in photosynthesis is
    14·1 answer
  • Why does a muscle cell have more mitochondria than other cells?
    5·1 answer
  • What are the terms used to describe locations on a sand dune?
    6·2 answers
  • Which of these is an example of how a person could help the environment
    7·2 answers
  • Which process describes the movement of molecules from areas of low consternation
    5·1 answer
  • The accuumulation of sediment found along a lake or a ocean
    6·1 answer
  • Chemical weathering is noted by
    6·1 answer
  • 1. The correct order for the smallest to the largest unit of organization in muscle tissue is
    5·1 answer
  • Water, ice, wind, sand, and chemicals are constantly crumbling mountains, flattening hills, widening valleys, and deepening cany
    15·1 answer
  • Hematopoietic stem cells are _____ cells that develop into _____ cells.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!