1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
9

Why does Anne wish Peter had a religion?

Biology
1 answer:
Annette [7]3 years ago
4 0

Answer:

Anne admires that Peter is willing to humble himself for the sake of peace, even when he knows he's right. In Anne's mind, 'Peter Schiff and Peter van Daan have melted into one Peter, who's good and kind and whom I long for desperately.  Explanation: GETBACKGANG STRETCHGANG O.T.F O BLOCK?600

You might be interested in
How homologous structures and vestigial structures are evidence of evolutionary relationships.
natali 33 [55]

Answer:

Due to presence of these structures in ancient as well as modern organisms.

Explanation:

Homologous and vestigial structures are the evidences that show  evolutionary relationships between organisms because these structure were also present in the ancient ancestor of that organism. These homologous and vestigial structures shows the relationship between the ancient and the modern organisms. Some structure has a purpose and function in the body of ancient organisms but with the passage of time those structure are useless and have no function in the body but these structure shows connection between modern and ancient organisms.

3 0
3 years ago
How attitudes and safety skills may deal with the impact of environmental factors at a personal level?
NemiM [27]

Answer:Human approach, attitudes and adherence to the safety skills does deal with the impact over environmental factors at a personal level. We have to be more careful and cautious while we pursue our own habits, and activities, with the aim of posing less harm to the environment in any way.

Explanation:

3 0
2 years ago
Large molecules made of many small subunits called
umka21 [38]

Answer:

Large molecules made up of many small organic molecules that are often referred to as monomers. Macromolecules are polymers of monomers.

sorry if I am wrong

3 0
3 years ago
Read 2 more answers
18) Which process occurs in fungi and has the opposite effect on a cell's chromosome number than does meiosis I?
grin007 [14]
That is binary fission, 'cause in this process, chromosome number doubles to it's original value whereas in meiosis it gets halved.

In short, Your Answer would be Option D

Hope this helps!
3 0
3 years ago
Read this passage:<br> BRUTUS: Who is here so base that would
Taya2010 [7]
What is the question?
3 0
3 years ago
Other questions:
  • Which cell structure is most affected by this lack of energy
    13·1 answer
  • This is a dna fingerprint exhibiting samples from a victim, two suspects, and the crime scene. which of these dna fragments is c
    14·1 answer
  • Do protists (amoeba, Euglena, Paramecium) use similar structures to move? Explain.
    13·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How do hair-like structures increase the surface area of the root hair cell?
    15·1 answer
  • Describe one energy conversion that takes place in a hydroelectric power plant
    5·1 answer
  • Global Warming is not a thing!
    14·2 answers
  • 1. MAINIDEA Explain how chemical energy is formed from the conversion of
    13·1 answer
  • Many industrialized countries exist in an ecological deficit due to their lack of productive land, overproduction of waste, or l
    13·1 answer
  • Whenever electrosurgical instruments are used, the irrigation fluid must be ________.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!