Brain Ischemia which is definetly fatal as the cells of the cerebrum will start to respire anaerobically and eventually the building up of lactic acid will be fatal
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
<span><span>The plant body consists of two basic parts--- the </span>shoot system<span> and the </span>root system</span><span>Shoot system<span> is above ground and includes organs such as </span>leaves, buds, stems, flowers, and fruits</span><span><span>The functions of the shoot system include </span>photosynthesis, reproduction, storage, transport, and hormone production</span><span><span>The </span>root system<span> is below ground and includes </span>roots as well as modified stem structures<span> such as tubers and rhizome </span></span><span><span>The functions of the </span>root system<span> include </span><span>anchorage, absorption, storage, transport, and production of certain hormones Hope this is what you were asking for! :)
</span></span>
The answer is d because the ovary's job is twofold. They produce the hormones including estrogen.