1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
2 years ago
11

How has non-renewable energy and technology improved but at the same time endangered our way of life ? (4 Points) a . Fossil fue

ls have allowed most countries to Improve their industry, economy, and livelihood. However, these nonrenewable energy sources have also caused environmental degradation of natural resources, ecosystems, and climate change. Technology or alternative energy is cleaner, and more sustainable which promotes a longer llfe expectancy for all specles. B. Non-renewable energy is great for our environment. The use of fossil fuels has been a great ecosystem service to the environment. Alternative energy such as Solar Power may cause mass extinction.
Biology
1 answer:
seropon [69]2 years ago
8 0

Answer: I think b

Explanation:

You might be interested in
What are the scientific goals for the Mars Science Laboratory?
Sergeeva-Olga [200]

Answer:

4

Explanation:

3 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
How does freezing and thawing break rocks a part
OLEGan [10]

Answer:

If water gets into a crack in a rock and then freezes, it expands and pushes the crack further apart.

Explanation:

7 0
2 years ago
It serves as passage way of air into the lungs
GalinKa [24]

Answer:

air travels down the pharynx (back of the throat), passes through your larynx (voice box) and into your trachea (windpipe). Your trachea is divided into 2 air passages called bronchial tubes. One bronchial tube leads to the left lung, the other to the right lung

Explanation:

3 0
3 years ago
Read 2 more answers
Which are electrical "nodes" of the heart? Check
mestny [16]

Answer:

sinoatrial node and atrioventricular node

5 0
3 years ago
Other questions:
  • Below is a picture of a forest. What will happen in the next few years?
    13·2 answers
  • Two sister chromatids are joined at the centromere prior to meiosis. Which statement is correct? a. These chromatids make up a d
    15·1 answer
  • for the freckles trait, having freckles (F) is dominant while no freckles (f) is recessive. What will someone that is Ff look li
    12·1 answer
  • 8. 20,000 to 22,000 in humans<br>gene<br>autosome<br>sex chromosomes<br> xx​
    15·1 answer
  • Why is it so important for measurement in experiment to be accurate ?
    13·2 answers
  • Identify two ways which space exploration has influed florida económico and culture
    10·1 answer
  • The arteries that branch from the aorta and provide blood to the heart muscle itself are _______________ arteries.
    13·2 answers
  • Describe the arrangement of the water molecule to molecule with one <br> another
    12·1 answer
  • Which are three human-body systems coordinate to cause arm to move? A. nervous, muscular, skeletal; B. respiratory, muscular, di
    6·2 answers
  • Write the relationship between cells, tissue and organs in human body.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!