Answer:
Exocytosis: It is defined as the process of membrane-bound vesicles fusing with the plasma membrane and later releasing their contents to the extracellular part of the cell.
Endocytosis: It is defined as the process of capturing a particle from outside the cell by the engulfing process with the cell membrane. It is basically two types:
1) Pinocytosis: Cellular drinking.
2) Phagocytosis: Cellular eating.
Respiration is the reverse of Photosynthesis.
Going back to naming and classifying all of the living organisms, let us take a look at what can be the difference between<span> a specie and </span>population<span>. ... It is defined as the organisms capable of sexual intercourse and producing offspring which are fertile and able to produce as well
</span>
Answer:
C .they take up the usable forms of nitrogen found in the soil .
Explanation:
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
