1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
5

The best definition of the term prognosis is the: a. number of remissions to be expected during the course of a chronic illness.

b. precipitating factors causing an acute episode c. predicted outcome or likelihood of recovery from a specific disease d. exacerbations occurring during chronic illness
Biology
2 answers:
KATRIN_1 [288]3 years ago
8 0

Answer:

i don't know

Explanation:

kumpel [21]3 years ago
5 0

Answer:

Best answer is going to be "C"!

Explanation:

The definition of prognosis is "The likely course of a disease or ailment"

You might be interested in
How do<br> you<br> think<br> your<br> food sources<br> compare to the breakdown
uysha [10]

Answer:

What we eat matters. The food choices we make every day have a big effect on the environment. The good news is that even small changes in what we buy and eat can add up to real environmental benefits, including fewer toxic chemicals, reduced global warming emissions, and preservation of our ocean resources.

Explanation:

5 0
2 years ago
Read 2 more answers
After collecting samples of the material found growing on last month's leftovers at the back of your fridge, you realize that yo
skad [1K]

The correct answer is eukaryotic cells.

Microscopic subunits within the cell represent the organelles found only in complex eukaryotic cell. The communication between those organelles via signal molecules are also a good example of the functioning of eukaryotic cell.

Eukaryotic cell is a cell that contains a nucleus and organelles, and is enclosed by a plasma membrane.


5 0
3 years ago
Which of the statements are true? Yeast cells that produce more unsaturated fatty acids than saturated fatty acids in response t
Feliz [49]

Answer:1)Yeast cells that produce more unsaturated fatty acids than saturated fatty acids in response to cold have greater cold tolerance

2)Cell membranes in reindeer legs (near the hooves) are kept flexible because they have a large number of saturated fatty acids.

3.)Cell membranes in cold tolerant winter wheat plants have a higher ratio of unsaturated fatty acids to saturated fatty acids than do cold intolerant wheat varieties.

Explanation.

Basically the longer the chains of fatty acids the higher the degree of energy produced as heat energy, and therefore the higher the insulation.

Unsaturated fats clogged together and the aggregate carbons and hydrogens ensured insulation.

5 0
3 years ago
Which of the following are dwarf planets? Check all that apply.
Natali [406]
Pluto, Eris, Haumea, Ceres, and Makemake are the answers to this question.
4 0
2 years ago
Read 2 more answers
What scalar quantity do you need to determine the rate of motion?
Sunny_sXe [5.5K]

Answer:

A vector quantity has a direction and a magnitude, while a scalar has only a magnitude. You can tell if a quantity is a vector by whether or not it has a direction associated with it.

Explanation:

Example: Speed is a scalar quantity, but velocity is a vector that specifies both a direction as well as a magnitude.

4 0
3 years ago
Other questions:
  • The respiratory pump facilitates the return of blood to the heart by ________.
    14·1 answer
  • Coals ,oils and gas are examples of
    6·1 answer
  • Give an example of a this characteristic of life for an animal and for a plant.
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of the statements below is NOT TRUE about meiosis and/or mitosis.
    7·1 answer
  • Which of the following nucleic acids are composed of nucleotides
    9·1 answer
  • What is the best way for women to Masterbate? It's for my anatomy class...please it’s due in an hour!!!
    6·2 answers
  • What is biotechnology?​
    8·1 answer
  • Which two human activities are believed to be the greatest contributors to global warming?
    6·2 answers
  • Based on their total biomass, earth
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!