1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuliya22 [10]
3 years ago
9

Describe how meat, fish, chicken, eggs, dairy products, and fresh vegetables should be stored, transported, and properly prepare

d for cooking. explain how to prevent cross-contamination.
Biology
1 answer:
mamaluj [8]3 years ago
3 0
:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D:D
You might be interested in
One of the following is NON-polar molecule
nlexa [21]

Answer:

a. fatty acids is the correct answer.

Explanation:

fatty acids is NON-polar molecule.

Nonpolar molecules are that molecules which are not soluble in water and fatty acids are not soluble in water.

fatty acids are hydrophobic and the hydrocarbon chain present in fatty acids are nonpolar, thus that's the reason fatty acid is nonpolar.

examples of fatty acids

  • fats
  • cholesterols
  • oils
  • steroids

4 0
2 years ago
A substance is very sour and has a ph of 4. what color would you expect it to turn a piece of litmus paper
Anika [276]
If a substance is very sour and has a ph of 4, then you would expect the litmus paper to turn into the shade of red. A substance that is sour and has a pH level that is below 7 would indicate that the substance is an acid or has acidic properties. For an acidic solution, the litmus would be red in color. If a blue litmus paper is used, then it would turn into red while if a red litmus paper is used, then it would remain as red. There is also a general type of litmus paper where the color change range from violet to red. A litmus is widely used in distinguishing acid and bases. It can be used in liquid solutions and in gas mixtures. <span />
4 0
3 years ago
Which of the following structures: make energy for the cell
Anna35 [415]

Answer: mitochondria

Explanation:Animals and plants are made up of many complex cells called eukaryotic cells. Inside these cells are structures that perform special functions for the cell called organelles. The organelle that is responsible for producing energy for the cell is the mitochondria And cellular respiration.

6 0
3 years ago
On her first prenatal visit to the doctor, marlene is warned about the dangers of alcohol and pregnancy. what is the condition t
weqwewe [10]
<span> the answer is Fetal alcohol syndrome</span>
4 0
2 years ago
Variables for how does adding fertilizer affect the growth of a plant?
elena-s [515]

Answer:

Environmental factors that affect plant growth include light, temperature, water, humidity, and nutrition. It is important to understand how these factors affect plant growth and development.

Explanation:

4 0
3 years ago
Other questions:
  • The process of protein synthesis is consist of
    15·1 answer
  • Which best matches a list that a scientist would make to describe a forest ecosystem
    6·2 answers
  • In cocker spaniels the allele for a black coat color (B) is dominant over the allele for a brown coat color (b). If a brown cock
    14·1 answer
  • What happens to macromoleclues from food during digestion
    8·2 answers
  • Answer the below question choosing either a,b,c,d
    14·1 answer
  • What name should be used for the ionic compound Cu(NO3)2?
    7·2 answers
  • 1. Different organs are connected by tubes or vessels to create_____.
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • USE PICTURE ABOVE!! NEED ANSWERS ASAP!!! 8. Categorize What types of bonds are present in
    14·1 answer
  • Discuss how alcohol can affect the human body and what are some ways to recover from the negative impacts alcohol can cause.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!