All categories

3 years ago

Which statement describes the synapse?

Biology

2 answers:

katrin2010 [14]3 years ago

8 0

Answer:

Explanation:

Harlamova29_29 [7]3 years ago

4 0

<h2><u>Answer:-</u></h2>

$\pink{\bigstar}$ $\large\underline{\underline{\bf\green{Synapse:-}}}$

✯ Synapse is the gap between neurons that ensures that information travels in one direction only.

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

Therefore, the 2nd statement [B] is correct.

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

<h3> $\pink{\bigstar}$ <u>Addit</u><u>ional</u><u> </u><u>Inf</u><u>ormation</u><u>:</u><u>-</u></h3>

A Synapse is a small gap at the end of a neuron that allows a signal to pass from one neuron to the next. Synapses are found where nerve cells connect with other nerve cells. Synapses are the key to the brain's function.

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

The term synapse was first introduced in 1897 by Michael Foster in his "Textbook of Physiology" and derived from the Greek synapsis, meaning "conjunction."

You might be interested in

What problems can pseudoscience cause for society?

KIM [24]

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

5 0

4 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Bacterial DNA is circular and arrayed in a region of the cell known as what? Answers: nucleus, nuceloid, mitochondria, Golgi app

Oksi-84 [34.3K]

I believe the answer is nuceloid

6 0

3 years ago

Read 2 more answers

The axial skeleton contains skull,

aev [14]

Answer:

Explanation:

Answer

6 0

3 years ago

PLEASE HELP ASAP!

Vlad [161]

Answer: Maybe if you knew the def's you could answer it.

Initial Decay – Bacteria located mainly in the lower intestine begin decomposition, giving a greenish color to the lower abdomen. Stage 2: Putrefaction – Bacteria grow throughout the body, releasing gases, including cadaverine, which in turn bloat the body and cause unpleasant odor.

putrefaction

the process of decay or rotting in a body or other organic matter.

Black putrefaction occurs, which is when noxious odors are released from the body and the parts of the body undergo a black discoloration. 2 weeks: The abdomen is bloated; internal gas pressure nears maximum capacity. 3 weeks: Tissues have softened. Organs and cavities are bursting.

Fermentation occurring in putrefaction and apparently in the digestion of herbivorous mammals in which butyric acid is produced by certain chiefly anaerobic bacteria acting upon various organic substances (such as lactic acid or butter)

A dry body will not decompose efficiently. Moisture helps the growth of microorganisms that decompose the organic matter, but too much moisture could lead to anaerobic conditions slowing down the decomposition process

6 0

3 years ago