1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
2 years ago
12

What is one difference between natural selection and artificial selection?

Biology
1 answer:
Goshia [24]2 years ago
4 0

Answer:

B

Explanation:

Natural selection and selective breeding can cause changes in animals and plants. The difference between the two is that natural selection happens naturally, but selective breeding only occurs when humans intervene. For this reason, selective breeding is sometimes called artificial selection.

You might be interested in
Why would these modifications be important i.e.<br>what unique feature does Arthrobotrys have?)​
Drupady [299]

Answer:

Forming adhesive trapping nets.

Explanation:

These modifications are important to captured its food and to survive in the environment. Unique feature does Arthrobotrys have is the presence of predatory behaviour. Due to this predatory behaviour of Arthrobotrys, they are able to capture the food such as nematodes and feed on them. The Arthrobotrys belongs to the fungi family Orbiliaceae and have 71 species. This fungi formed adhesive trapping nets in order to capture its food.

5 0
3 years ago
Scientists often form hypotheses based on particular observations. Which of the following is NOT true of a good hypothesis?
snow_tiger [21]
The correct answer is A, a good hypothesis does not have to be complex
5 0
3 years ago
Which form of cell reproduction allows your skin to heal after a cut?.
viva [34]

Answer:

Mitosis is the reason we can grow, heal wounds, and replace damaged cells. Mitosis is also important in organisms which reproduce

8 0
2 years ago
What is the density of an object that has a mass of 30g and a volume of 50cm3 ?
algol [13]

Answer:

0.6g/cm³

Explanation:

density = mass/volume

density = 30/50 = 0.6g/cm³

7 0
3 years ago
A close relationship between two species that benefits at least one of the species is called
kotykmax [81]
Symbiosis is the name given to a close relationship between organsims of different speciies. Usually one of the species benefits.
4 0
3 years ago
Read 2 more answers
Other questions:
  • According to the cell theory, cells come from ________________. spontaneous generation photosynthesis other living cells cellula
    10·1 answer
  • A scientist wanted to formulate a pill to attack a specific type of bacteria that infects the throat. Which biological component
    6·2 answers
  • PLEASE HELP!!! WILL GIVE BRAINLIRST AND POINTS
    14·2 answers
  • Many species are introduced into new areas every day through ballast water and international shipping; however, not all of these
    7·1 answer
  • Which is an ion found in a glass of water?<br> A. N+<br> В. ОНЫ<br> C. 0<br> D. H-
    14·1 answer
  • "Dyslexia is more common in girls than boys." "Most people with dyslexia naturally outgrow it as adults." "Dyslexia has a biolog
    6·2 answers
  • Here are some suggested documents to use which provide information on the importance of soils, what happens in soil erosion, and
    5·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Answer and I will give you brainiliest <br>​
    13·2 answers
  • Helppp, i’m going to fail:(
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!