3 years ago

I will mark brainliest

Biology

1 answer:

ExtremeBDS [4]3 years ago

6 0

Answer:

Explanation:

Cause after 6 the graphed line stays the same, which means it stopped growing.

You might be interested in

WORTH 50 POINTS!!

AnnZ [28]

The correct answer is D

4 0

3 years ago

-Can someone help me translate this sequence into RNA. T A C T T A A G T A T G-

geniusboy [140]

Answer: U T G U U TT C U U A C

Explanation:

8 0

3 years ago

How are growth and reproduction related

PolarNik [594]

Growth is needed for reproduction and reproduction is need for growth so you could say that they are dependent upon each other

7 0

3 years ago

Elaborate on the changes in molecular motion of particles as they change from solid to liquid to gas.

12345 [234]

As the phase changes occur, the freedom of motion of the particles increases.

6 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago