1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zimovet [89]
3 years ago
13

Help me quick please, its a test!!

Biology
1 answer:
Licemer1 [7]3 years ago
7 0

Answer:

cellular resperation; ATP;energy;digestive system;circulartory ;energy; glucose; water; carbon dioxyide ; mitocondria

Explanation:

 

You might be interested in
What is the rate of temperature change as the air warms up from 52C at 6:00am to 68C at 10:00an?
PSYCHO15rus [73]

Answer:

4C/hr

Explanation:

68-52=16 gives us the temp change, so you divide it by 4 hours for the temp increase each hour 16/4=4

6 0
2 years ago
Slight differences in inherited traits, such as feather color in birds, are called
Sergeeva-Olga [200]
The answer is letter C. |
<span>
Slight differences in the color of feathers in birds are the result of mutations. Mutation is process that occurs through a long period of time. It is a process in which the genes’ structures changes thus altering the physical characteristics and behaviors of species. This results into variant forms that may be transmitted to the next generations of species. Mutation is caused by an alteration of single base units in DNA, or the deletion, insertion, or rearrangement of larger sections of the genes or chromosomes. </span>
3 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
All cells contain a phosphate buffer system within their internal fluid to help maintain a constant pH. This system can be summa
Sloan [31]
The correct answer is A. maintaining homeostasis.
Homeostasis is a term referring to an organisms continuous process of maintaining and auto-regulating the conditions of its internal environment. Variables such as pH, temperature, and fluid balance need to be at optimal conditions in order for the organism to function properly.
In this example, the phosphate buffer system permits the organisms to maintain a constant pH in their intracellular fluid. This is one of the organism's homeostatic mechanisms.     

3 0
3 years ago
What is the fitness of an organism
sashaice [31]

Answer:

Darwinian fitness

Explanation:

it is able to produce offspring of itself and help it to Maintain the population of an organism

hope it helps u

6 0
3 years ago
Other questions:
  • The retina, which is a collection of nerve cells at the back of the eye, extracts basic information, which it then sends to the
    9·1 answer
  • Which neurotransmitter is primarily responsible for the generation of behaviors observed during dowsing?
    15·1 answer
  • A scientific theory can be incorrect but still be considered a good scientific theory. How can this be?
    7·2 answers
  • The process by which a white blood cell engulfs, digests, and destroys a microscopic foreign invader is known a
    9·1 answer
  • 6 At what temperature does liquid
    8·2 answers
  • Part D
    9·1 answer
  • A friend of mine came to see me one day and told me a story of how he met his identical twin that he never knew about. When I qu
    14·2 answers
  • 11. Where are subduction zones likely to form?
    5·1 answer
  • Which of the following is true about protein molecules?
    15·1 answer
  • What is the BEST definition of deciduous?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!