1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Volgvan
3 years ago
9

Describe the difference in pressure agaisnt your cheeks when they are full of air versus when its released

Biology
1 answer:
guajiro [1.7K]3 years ago
3 0
The pressure is more present when full with air as you’re holding them to expand the area to let more air in. That’s my quickest response.
You might be interested in
Explain the process of transcription
Klio2033 [76]
Transcription is the process in which mRNA is produced from DNA by using transcriptase enzyme.it involves the following process:splicing,5 END methylation cup,3 end polytail A .
5 0
3 years ago
Read 2 more answers
This is the question i need help with<br> select all that applies
Genrish500 [490]
3rd and 4th awnsers are correct
4 0
3 years ago
Imagine that a team of scientists test a certain hypothesis, and the experimental results show that it is false. How will
tekilochka [14]

Answer:

the results will likely be recording and could inspire a new hypothesis.

Explanation:

7 0
3 years ago
Function of graffian follicle <br>​
Diano4ka-milaya [45]

Answer:

It provides for the maturation and release of a fertilizable oocyte

Explanation:

let me know if you have any questions

7 0
3 years ago
A ______ is anything in the environment that affects the behavior of an organism.
Svetach [21]

Answer:

Heyaaa!!! Your answer for this question will be....

Explanation:

!!! <u><em>Stimulus aka (D)</em></u> !!!

<em>Lmk If You Have Any More Questions!</em>

<em />

<em>  </em><em>Have A Nice Day!!</em>

<u><em>~Pinky~</em></u>

7 0
3 years ago
Read 2 more answers
Other questions:
  • The main immediate source of atp (lasting about 10 seconds) as muscle contractions begin comes from
    13·1 answer
  • _____consists of 6 different dimensions-physical, emotional, intellectual, spiritual, social, and environmental. A. Health B. We
    8·2 answers
  • What is the highest level in the organizational hierarchy of the human body
    12·2 answers
  • What do we call the area of
    10·2 answers
  • 3. The enzyme DNA polymerase works only in the 5' to 3' direction. How does this affect the leading strand and the lagging stran
    11·2 answers
  • While listening to sad rather than happy music, people are more likely to perceive a spoken work as mourning rather than morning
    15·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • PSYCHOLOGY <br> Briefly describe the relationship between hormones, emotion, and external behavior
    6·1 answer
  • What’s the difference between a theory and a hypothesis
    15·1 answer
  • In the cells of most organisms, DNA is contained in the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!