1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crazy boy [7]
4 years ago
9

what is the timer for the increase in genetic variation that occurs when animals move into another population? Gene flow, sexual

selection, natural selection, genetic disruption

Biology
1 answer:
polet [3.4K]4 years ago
7 0
Gene flow is the answer
You might be interested in
Nitrates are made by converting ammonia (NH3) to nitrite (NO2-) and then to nitrate (NO3-). What do you predict the O2 levels in
AlexFokin [52]

Answer:

Low - The generation of nitrates (NO 3-) requires oxygen, so the oxygen levels will be low

Explanation:

Nitrates are formed when the ammonia react with oxygen present in water. The oxygen which react with ammonia is not the oxygen of water molecule, it is the dissolved oxygen. This oxygen is used by aquatic animals for breathing. If nitrates are formed so the concentration of dissolved oxygen will be lowered which causes suffocation and bad impact on marine organisms and the whole ecosystem will be disturbed.

6 0
3 years ago
A garden contains 40 flowers, 30 of which are red. What is the frequency of red flowers? (1 point)
lakkis [162]
It is d

Explanation: 40/30=0.75 because there are 40 flowers in total and only 30 are red so the % of there being red flowers is 75% or 0.75 (same thing)
3 0
3 years ago
Read 2 more answers
Which of the following speak a language?<br><br> A. chimps<br> B. bees<br> C. humans<br> D. dolphins
kykrilka [37]
The correct answer is C. humans

Language is an advanced system for communication available only to humans. Dolphins, chimps, and bees, use other means to communicate, but it is not a language, it's mostly things like smells or pheromones or similar things.
6 0
4 years ago
I have no questions xp
grin007 [14]

Answer:

That's cool :)

Explanation:

4 0
3 years ago
Type several paragraphs describing the full carbon cycle in detail. i. Discuss all components of your poster, as outlined in ste
tester [92]

Answer:

The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms

Explanation:

8 0
3 years ago
Other questions:
  • What is the term usedfor an organism’s ability to maintain stable internal conditions even when its outside enviorment changes?
    8·2 answers
  • Explain how stars and constellations can serve as landmarks for other stars and constellations
    6·1 answer
  • In your own words, explain how stalactites are formed in caves.
    14·1 answer
  • Which are components of cell theory? Check all that apply.
    15·2 answers
  • What is the gel-like fluid that fills the cell and surrounds the organelles?
    8·2 answers
  • Team of scientists is studying several plant species that they think could become new farm crops. The scientists want to apply s
    7·1 answer
  • Can someone help me? Suppose a paleontologist discovered a fossil skull that he believes might be distantly related to primates.
    5·1 answer
  • A nursing instructor is explaining the role of vascular smooth muscle cells in relation to increases in the systemic circulation
    6·1 answer
  • How does the excretory system work with the muscular system?
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!