1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Diano4ka-milaya [45]
2 years ago
5

Is thermal energy, or heat, transferred by conduction, convection, or radiation in a geyser? How do you know? Explain.

Biology
1 answer:
Kruka [31]2 years ago
6 0

Answer:

i think conduction cause it depends on how fast it can heat up

Explanation:

also this is not a biology quiestion

You might be interested in
1.
Leto [7]
1. Sustainable 2. Environmental
3 0
3 years ago
What is the plant tissue responsible for limiting water loss?
anyanavicka [17]
A. dermal tissue inhibits water loss.
3 0
3 years ago
Read 2 more answers
Why is so little of Earths surface found far above sea levels​
jonny [76]

Hello! :)

The eroded material finds its way to the bottom of oceans because of gravity (from... According to the hypsometric curve (plot between elevation and % of earth's surface), only about 29% of Earth's surface is above the mean sea level, rest 71% has an elevation less than mean sea level.

Hope this helped and I hope I answered in time!

~ Destiny ^_^

5 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Can someone help me please
Alborosie
It is the Digestive system :)
4 0
3 years ago
Other questions:
  • A drug company is testing the effectiveness of a new blood pressure medicine using rats at the test subject describe the experim
    11·1 answer
  • Which of the following is not a factor influencing preventive measures used to combat the spread of disease? A. Antibiotics B. S
    13·2 answers
  • The suprachiasmatic nucleus of the ________ is responsible for regulating your circadian rhythms. In this way it plays a very im
    12·1 answer
  • According to the food chain, trout are a major source of food for bears. What would happen to the trout population if the bear p
    11·1 answer
  • ¿Para qué los flamencos tienen patas largas?
    13·2 answers
  • Which type of alternative energy can produce ethanol? A. hydropower energy B. solar energy C. biomass energy D. wind energy
    10·2 answers
  • _____ can be passed from mother to child via breast milk.
    13·1 answer
  • The answer is D!!! What was the purpose of Miller and Urey's experiment?
    12·1 answer
  • A small crab will make its home inside a mussel, obtaining food and shelter while the mussel simply tolerates the situation. In
    9·2 answers
  • HELP!!! WILL GIVE MAX POINTS!! Doing a Lab Report on Natural Selection about beans. For example 20 dark red beans and 35 light r
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!