1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marissa [1.9K]
3 years ago
8

A major factor that negatively affects biodiversity is

Biology
1 answer:
Sauron [17]3 years ago
6 0

Answer:

A because i did this answer on one of my test

Explanation:

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
A native forest is complex and biodiverse. Once disturbed, it is impossible to
Andreas93 [3]

Answer: Reclaiming and replanting forests in deforested answers

Explanation: just took quiz

4 0
3 years ago
Freckles are a dominant trait in humans. Both of the girls have the genotype FF for freckles. If either one marries a man with n
sweet [91]

The answer is actually 100%

5 0
3 years ago
As a molecule moves through the plasma membrane it passes through a hydrophobic layer of phospholipid tails then a hydrophilic l
Firdavs [7]

Answer:

"As a molecule moves through the plasma membrane it passes through <em>a hydrophilic layer of phospholipid heads then a hydrophobic layer of phospholipid tails and then another hydrophilic layer of phospholipid heads".</em>

Explanation:

Biological membranes are formed by two lipidic layers, proteins, and glucans.

Lipids characterize for being amphipathic molecules, which means that they have both a hydrophilic portion and a hydrophobic portion at the same time. These molecules have a lipidic head that corresponds to a negatively charged phosphate group, which is the polar and hydrophilic portion. They also have two lipidic tails that correspond to the hydrocarbon chains -the apolar and hydrophobic portion- of the fatty acids that esterify glycerol.

Membrane lipids are arranged with their hydrophilic polar heads facing the exterior and the interior of the cells, while their hydrophobic tails are against each other, constituting the internal part of the membrane.

Through this lipidic bilayer, some molecules can move from one side of the cell to the other, which happens because of concentration differences. When this occurs, molecules must pass through the hydrophilic layer of phospholipid heads then through the hydrophobic layer of phospholipid tails and then again through another hydrophilic layer of phospholipid heads.              

3 0
3 years ago
Which of the forest management practices keeps the florist in a state of mid to late succession
Ivahew [28]

D. seed-tree cutting

3 0
4 years ago
Other questions:
  • An adolescent client with an antisocial personality disorder has been admitted to the hospital because of drug abuse and repeate
    11·1 answer
  • Reproductive isolation is not an accurate term to describe populations of a species that
    15·1 answer
  • How do basophil cells react when a pathogen enters the body
    7·1 answer
  • How do animals get nitrogen?
    6·2 answers
  • A group of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. If the mitocho
    5·1 answer
  • Which of these describes a quantitative observation?
    8·2 answers
  • What does the fossil record tell us
    10·1 answer
  • You are an evolutionary entomologist. You have observed beetles that can raise their abdomens and give off a defensive chemical
    6·1 answer
  • Which of the following are an example of stimuli? Check all that apply.
    11·2 answers
  • Last question of my 50 question test plz help
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!