1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luda [366]
2 years ago
10

Jane conducted a simple experiment to see which soil would make her tomato plants grow the tallest. She planted two groups of to

mato plants in her back yard, ensuring they all got the same amount of sunlight and water. She planted the two groups in different types of soil and recorded the results. Which is the independent variable in Janes experiment? AND THE DEPENDENT
Biology
1 answer:
liraira [26]2 years ago
3 0

Answer:

independent is the soil dependent is how tall they grow

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
This organelle functions in cellular respiration ?
Anna35 [415]

<em>The organelle function in cellular respiration is the;</em>

D) Mitochondrion

<u>The Mitochondria is the main organelle involved in respiration. </u>

8 0
3 years ago
Read 2 more answers
3. What is the difference between cotyledons in dicot seeds and the endosperm in monocot seeds?
cupoosta [38]

Explanation:

Monocots contain a single cotyledon in their seed and dicots contain two cotyledons. The nutrients in the endosperm of dicots is absorbed by the two cotyledons. Therefore, a tiny endosperm is found inside the dicot seed. However, the main difference between cotyledon and endosperm is in their function during seedling.

7 0
2 years ago
Which bonds are found inside a water molecule, between hydrogen and oxygen?
VikaD [51]

Answer:

Hydrogen Bonding in Water (1) The hydrogen bond in water is a dynamic attraction between neighboring water molecules involving one hydrogen atom located between the two oxygen atoms.

Explanation:

6 0
3 years ago
Read 2 more answers
What is the diploid of the zygote produced by fertilization—haploid or diploid?
nasty-shy [4]

Answer:

"Haploid" refers to any cell that has 23 chromosomes (half of the total 46). "Gametes" are specifically sex cells that have 23 chromosomes. "Diploid" refers to any cell that has all 46 chromosomes. "Zygote" is the result of two gamete (haploid) cells fusing, and becoming a diploid cell.

hope this helps!!:)

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Chain of hemoglobin is 1 m.u. from the albino locus. assume for the moment that the same is true in humans. the disease sickle-c
    7·1 answer
  • How do chloroplasts get energy from sunlight?
    13·2 answers
  • Why are birds blue?
    12·2 answers
  • Which of the following describes a positron emission tomography (PET) scanner? 1: A device that uses magnetic fields to produce
    11·1 answer
  • In seed plants the sperm make it to the egg via
    5·1 answer
  • Which property of water is shown in diagram A?<br> A<br> B
    8·1 answer
  • Which of the following WAS NOT a product that the Chinese traded with the Dutch Republic?
    7·1 answer
  • Enzymes are ___________ that speed _______ reactions by lowering _________________ ________. Proteins _________ in extreme condi
    7·1 answer
  • People in which environmental career category are directly involved in designing structures that aid humans to function in natur
    8·2 answers
  • The change in the position
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!