1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zlopas [31]
2 years ago
7

Before deciding on a medium to use, what should the presenter do?(1 point)

Biology
1 answer:
mixer [17]2 years ago
4 0

Answer:

♡ madeline here! ♡

- -it's c ʕ •ᴥ•ʔ

hope I could help! have a great day

✧・゚: *✧・゚:・゚✧*:・゚✧・゚: *✧・゚:・゚✧*:・゚✧

.

Explanation:

You might be interested in
Where does energy enter the plant system
satela [25.4K]

Answer:

the roots

Explanation:

you gotta know this one

4 0
3 years ago
_______ is a condition that is characterized as long, narrow trunk, short limbs, and a large head. down syndrome turner syndrome
kozerog [31]
ACHONDROPLASTI DWARFISM is a condition that is characterized as long, narrow trunk, short limbs and a large head. It is the most common type of dwarfism and it occurs in about 1 out of 40.000 babies. Other features of the condition include: protruding jaw, flattened bridge of the nose, forward curvature of the lower spine and bow legs.
7 0
3 years ago
Questions.<br> Questions<br> 1 a Name the microorganism which causes the disease smallpox.
valina [46]

Answer:

Variola virus.

Explanation:

Smallpox is caused by a virus named as Variola virus.

4 0
3 years ago
Read 2 more answers
Explain how many cells are produced from one fertilised egg, after two cell divisions by mitosis
nikklg [1K]
Human sperm and eggs contain 23 chromosomes. Human zygotes contain 46<span> chromosomes. The type of cell division that produces gametes with half the normal chromosome number is called meiosis. It is used to produce cells for repair and asexual reproduction.</span>
4 0
3 years ago
Question 27
inn [45]

Explanation:

The answers are: C D E. Cells are semi-permeable which means it chooses what nutrients and h2o to enter and excretes cell waste into the bloodstream.

3 0
3 years ago
Other questions:
  • What is a quadrat.<br> need help nowww!!!!
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A biome of water plants and animals is ______. a: aquatic b: hydrophobic
    5·1 answer
  • What is the name of the unique area (specific region) that a lymphocyte recognizes and binds to?
    15·1 answer
  • Cross the following blood types OO and AB.
    9·1 answer
  • How can marine mammals survive underwater for so long?
    7·2 answers
  • The HPA axis of the endocrine system works together with the sympathetic nervous system to increase an individual's heart rate,
    10·1 answer
  • As we go from kingdom to species, what happens to the groups within each level of organization?
    8·1 answer
  • Which of the following nitrogen
    6·1 answer
  • During which season do the rays of the sun hit the Earth at the MOST indirect angle? A) fall B) spring C) summer D) winter
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!