1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
3 years ago
12

The light from a star moving away from us would be experiencing:

Biology
1 answer:
Yuki888 [10]3 years ago
8 0
The answer is A, redshift
You might be interested in
Whaere is the nucleus found
Vitek1552 [10]
The nucleus is located in the center (approximately) of a eukaryotic cell. It is kept separate from the rest of the cell with a plasma membrane,
8 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Sometimes the sequence of dna gets mutated and an adenine is paired to a cytosine. Why is this interaction unstable?
kirza4 [7]

Answer;

-Because the chemical groups that form hydrogen bonds are in the wrong positions.

Explanation;

-A base pair is any of the pairs of nucleotides connecting the complementary strands of a molecule of DNA or RNA and consisting of a purine linked to a pyrimidine by hydrogen bonds.

-The base pairs are adenine-thymine and guanine-cytosine in DNA, and adenine-uracil and guanine-cytosine in RNA or in hybrid DNA-RNA pairing. A mutation in the sequence of DNA that makes an adenine to be paired with a cytosine results to an unstable interaction because the chemical groups that form hydrogen bonds are in the wrong positions.

4 0
3 years ago
A student brings a specimen and claims it is a living organism . explain how a microscope could be used to determine if the spec
butalik [34]
It could show if the specimen is still functioning
4 0
3 years ago
Reciprocal altruism can be best explained with a model proposed by Robert Trivers in 1971. Trivers hypothesized that if one indi
Leni [432]

Answer:

Reciprocal altruism is one of the altruism behaviors in which an individual organism helps in increasing the fitness of another organism by reducing the fitness of itself temporarily in expectation of the same behavior from another organism in the future later.

It takes place in the same set of organism partners which is a continuous interaction ion in stable groups of organisms.

Thus, the correct answer would be - an ongoing interaction in the same set of partners.

6 0
3 years ago
Other questions:
  • Chemical Structure of cellulose diagram
    7·1 answer
  • You are a geneticist who is analyzing someone’s sex chromosome. It shows as XO. Which of the following disease or disorder does
    12·1 answer
  • Seeds (dominant) and wrinkled seeds (recessive)
    8·1 answer
  • Name three carbohydrates that contain glucose as a monomer.
    11·1 answer
  • Imagine a deer that lives in a meadow. When the deer dies what happens to its remains?
    10·2 answers
  • DNA binding proteins in prokaryotes regulate gene expression by controlling transcription
    12·1 answer
  • What would cause a person’s eye color to change from blue to green while that person was a child?
    14·1 answer
  • MATCHING - BACTERIAL NUTRITION
    14·1 answer
  • Which molecule most likely has the greastest amount of stored energy in its bond
    6·1 answer
  • Tami is growing a species of algae in a test tube containing a trace amount of phosphate. The algae multiply until all the phosp
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!